ID: 1070968202

View in Genome Browser
Species Human (GRCh38)
Location 10:80542927-80542949
Sequence GCTCAGAGCACTCTGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070968202_1070968212 22 Left 1070968202 10:80542927-80542949 CCAGCCAGCAGAGTGCTCTGAGC 0: 1
1: 0
2: 2
3: 18
4: 227
Right 1070968212 10:80542972-80542994 TGCCTCCATTCTCCACAGCTGGG No data
1070968202_1070968215 28 Left 1070968202 10:80542927-80542949 CCAGCCAGCAGAGTGCTCTGAGC 0: 1
1: 0
2: 2
3: 18
4: 227
Right 1070968215 10:80542978-80543000 CATTCTCCACAGCTGGGCTCAGG No data
1070968202_1070968211 21 Left 1070968202 10:80542927-80542949 CCAGCCAGCAGAGTGCTCTGAGC 0: 1
1: 0
2: 2
3: 18
4: 227
Right 1070968211 10:80542971-80542993 CTGCCTCCATTCTCCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070968202 Original CRISPR GCTCAGAGCACTCTGCTGGC TGG (reversed) Intronic
900592698 1:3467081-3467103 GCCTAGAGGACTCAGCTGGCGGG + Intronic
900665293 1:3811060-3811082 GCCCACTGCCCTCTGCTGGCTGG + Intergenic
901773102 1:11540840-11540862 GTTGATAGCACGCTGCTGGCCGG + Intergenic
902176782 1:14656374-14656396 GCTCAGAGGAGGATGCTGGCTGG + Intronic
902745057 1:18468375-18468397 GCTCTGGGCACTATGCTGGAAGG - Intergenic
902984030 1:20144507-20144529 GATCAGAGGTCTCTGCTGGTGGG + Intronic
903552200 1:24165667-24165689 GGTCAGAGATCCCTGCTGGCTGG - Intronic
904249530 1:29213168-29213190 GCCAAGAGCACTCTGAGGGCAGG + Intronic
905674457 1:39816038-39816060 GCTCAGAGCACACTACTGCCAGG + Intergenic
905917594 1:41696392-41696414 TCTAAGAGCACAGTGCTGGCGGG + Intronic
906291604 1:44623027-44623049 GCTCTGACCCCTCTCCTGGCTGG - Intronic
909872751 1:80764006-80764028 CCACAGAGCTTTCTGCTGGCTGG - Intergenic
912713947 1:111968768-111968790 GCTTCCAGCTCTCTGCTGGCTGG + Intronic
915305986 1:154978961-154978983 CCACAGAGCACTCATCTGGCTGG - Exonic
917211813 1:172639498-172639520 GCCCACAGCACTCTGCGGTCTGG - Intergenic
923002599 1:230020008-230020030 ACTCAGAGCACGTGGCTGGCTGG - Intergenic
924329277 1:242925910-242925932 GCTGAGATCATTCTCCTGGCAGG - Intergenic
924633377 1:245763045-245763067 GCCCAGGGCTCTCTGCTGTCTGG - Intronic
924934463 1:248756356-248756378 GTGCAGAGCACACTGCAGGCAGG - Intergenic
1063800043 10:9565812-9565834 GAAGAGAGAACTCTGCTGGCAGG - Intergenic
1064123411 10:12638628-12638650 CCTCAGAGTAGCCTGCTGGCTGG + Intronic
1065840709 10:29698358-29698380 CCACAGAGCACTCATCTGGCTGG - Intronic
1066299846 10:34087024-34087046 ACTCAGAGACCTGTGCTGGCTGG + Intergenic
1070650466 10:78231830-78231852 GCTCAGAGAATTCTGCAGGCTGG - Intergenic
1070968202 10:80542927-80542949 GCTCAGAGCACTCTGCTGGCTGG - Intronic
1070999209 10:80814539-80814561 GCTCAGGGCACTGGACTGGCAGG + Intergenic
1071510765 10:86261256-86261278 GCCCAGAGCTCTATGCTAGCAGG + Intronic
1073110956 10:101062760-101062782 GCGCGGCGCACTCTTCTGGCCGG - Exonic
1073467788 10:103704399-103704421 GCTGAGACCACACTGGTGGCTGG + Intronic
1073472684 10:103732859-103732881 GCACACGGCACTGTGCTGGCTGG + Intronic
1074295363 10:112183034-112183056 TCTCAGCGCATGCTGCTGGCTGG - Intronic
1076213761 10:128675540-128675562 GCTCACTGCACACTGCAGGCAGG - Intergenic
1076737991 10:132467269-132467291 GCTGAGAGCACTGAGGTGGCTGG - Intergenic
1077522218 11:3043165-3043187 GCTCTGAGCACACTGCTTCCAGG + Intronic
1078328415 11:10398764-10398786 CCTCAAAGCACTTTGCAGGCTGG + Intronic
1078760267 11:14245853-14245875 ACCCAGGGCACTCTCCTGGCAGG + Intronic
1079416649 11:20244158-20244180 GCACAGGGCCCTCTGGTGGCAGG - Intergenic
1081450595 11:43167699-43167721 GCTCAGTGCACTCTGAGTGCAGG - Intergenic
1081810891 11:45913642-45913664 GCCCAGAGAGCTCTGCGGGCGGG + Intronic
1083848755 11:65352974-65352996 ACACAGAGCCCTCTGCTGGATGG + Exonic
1084582880 11:70035161-70035183 GGTCATAGCTCTCGGCTGGCTGG - Intergenic
1086112054 11:83209821-83209843 CCACAGAGCACTCATCTGGCTGG - Intronic
1086144839 11:83540404-83540426 ACCCAGAGAACTCTGCTGGTGGG + Intronic
1089368176 11:117933866-117933888 TCTCAGGGGACTCTGCTGGTGGG + Intergenic
1089496682 11:118911568-118911590 GCTCTGAGCAGGCTCCTGGCTGG + Intronic
1090228507 11:125085582-125085604 GCTCTGGGGCCTCTGCTGGCTGG + Exonic
1091740546 12:2958420-2958442 GCTTAAAGCAGTGTGCTGGCAGG - Intergenic
1092112365 12:5972682-5972704 GCTCACTGCACACTGCTGGGAGG - Intronic
1092138642 12:6167452-6167474 GCACATAGGAGTCTGCTGGCTGG - Intergenic
1095673996 12:44895174-44895196 ACTTAGAGAACTCTGCAGGCTGG + Intronic
1096421246 12:51459794-51459816 GCTCACAGCTCTCTGCTGCCAGG - Intronic
1102992526 12:117325245-117325267 GCTTAGAGCACACGGCTGCCTGG - Intronic
1103954399 12:124568104-124568126 GCGCAGAGCCCTCTCCAGGCAGG + Intergenic
1104974983 12:132548290-132548312 GCCCAGGGCACCCTCCTGGCTGG - Intronic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1107454400 13:40540904-40540926 GTTCTGAGCACTCTGGGGGCAGG - Intergenic
1109954258 13:69545013-69545035 GCTCAGAGCTCACTGCAGCCTGG - Intergenic
1110326478 13:74221960-74221982 GCTCAATGAACTCTGCTGGCTGG + Intergenic
1113326779 13:109289900-109289922 GCTCAAAGCACTCATCTAGCCGG - Intergenic
1113388089 13:109869825-109869847 GCGCAGAGCCAGCTGCTGGCTGG + Intergenic
1113707420 13:112443792-112443814 GTGCAGAGCTCTCTGCAGGCAGG + Intergenic
1114322821 14:21561206-21561228 GCTAAGAGCAATGTGCTAGCAGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1118186747 14:63544117-63544139 GCTCTGAGCAGTCGGCTGACTGG - Intergenic
1120809874 14:88792603-88792625 GCTTAGAGGACGCGGCTGGCGGG - Exonic
1121736728 14:96223531-96223553 CCACAGAGCACTCATCTGGCTGG - Intronic
1122595260 14:102885935-102885957 CCTCAGAACAGTCTGCTGGTGGG - Intronic
1124166149 15:27327670-27327692 GCTCAGAGGACACTGCTGGAGGG - Intronic
1124609998 15:31201607-31201629 GCTCACAGCTCACTGCTGGGTGG - Intergenic
1124641828 15:31400679-31400701 ACTCAGATCACTCTGCTGTGTGG + Intronic
1127545377 15:59989446-59989468 GCTCAAAGCTCTCTGCCTGCAGG - Intergenic
1129767772 15:78181110-78181132 GCTCACAGAACCCTGGTGGCAGG + Intronic
1129993844 15:79987785-79987807 ACTCACAGCCCTCTGCTGCCTGG + Intergenic
1129994343 15:79991576-79991598 GTTCAAACCACTCTGCAGGCCGG + Intergenic
1130018001 15:80202130-80202152 GCTCAGACCACCCTGCAGGAGGG + Intergenic
1130049469 15:80471586-80471608 GATCAGAGCACTTAGCCGGCCGG + Intronic
1130057238 15:80537067-80537089 GCCCAGAGCACTCTTTTCGCAGG + Intronic
1131825920 15:96322489-96322511 GCCCAGAGCACACTCCGGGCTGG - Intergenic
1132406430 15:101544126-101544148 GCCCAGAGCCCTCCGCTGCCTGG + Intergenic
1132591058 16:726691-726713 GCTCAGGGCATCCTGCGGGCGGG - Intronic
1132656493 16:1043822-1043844 GCCCAGAGCTCCCTGCCGGCCGG - Intergenic
1132760974 16:1508576-1508598 GCTCAGACCTCTGTGCTGGGGGG + Intronic
1134627988 16:15736573-15736595 GCTCACAAAACTTTGCTGGCTGG - Intronic
1135994200 16:27236058-27236080 GCTGTGAGCATCCTGCTGGCAGG - Intronic
1136028855 16:27488354-27488376 GCTCCGAGCTCTGTGCTGGCTGG - Exonic
1136084835 16:27877516-27877538 GCTCCAAGCCCTGTGCTGGCTGG + Intronic
1136545802 16:30953984-30954006 GCCCAGAGGACCCTGCGGGCAGG - Exonic
1137682140 16:50358226-50358248 CCTTAAAACACTCTGCTGGCTGG + Intronic
1137852667 16:51762280-51762302 GCGCAGCGCCATCTGCTGGCAGG + Intergenic
1138128099 16:54455242-54455264 ACTCTGTGTACTCTGCTGGCTGG + Intergenic
1138276435 16:55738262-55738284 GCCCAGAGCCCACTGCAGGCAGG + Intergenic
1140717565 16:77740294-77740316 CCTCAGAACATTCTGCAGGCCGG + Intronic
1141023590 16:80521872-80521894 TCTCAGAGCACCCAGTTGGCTGG - Intergenic
1141671073 16:85491958-85491980 GCTCTGAGCACCCTGTGGGCTGG + Intergenic
1141986575 16:87584214-87584236 CCTCAGAGCTCACTGCTGTCTGG - Intergenic
1143256069 17:5558973-5558995 GCTCAGAGACCTCTGCTCTCTGG - Exonic
1143815197 17:9507094-9507116 GCTCAGGGCCTTCTGCTTGCAGG - Intronic
1143919213 17:10317597-10317619 GCTCAGAGCACCCTGCAAGGAGG + Intronic
1145414782 17:22705575-22705597 AAGCAGAGCGCTCTGCTGGCGGG + Intergenic
1148056894 17:44804477-44804499 GCTCAGGGGACTCTGGAGGCGGG - Exonic
1149455063 17:56781109-56781131 GCTGAGAGCACTCTGAAGCCAGG - Intergenic
1151359704 17:73581540-73581562 GCTCAGCGCCCACTGCTGTCAGG - Intronic
1152037849 17:77884247-77884269 GCACAGAGCTCACTGCTGGCTGG - Intergenic
1152278675 17:79372596-79372618 GCTCAGCCCAGTCTCCTGGCTGG + Intronic
1152748144 17:82050624-82050646 GCTCTGAGCTCTCTGCGGGTCGG + Intronic
1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG + Intergenic
1156456137 18:37295517-37295539 GCTCAGAGCATGCTGGAGGCAGG + Intronic
1160740032 19:681322-681344 GCTCACAGGACTCTGCAGGCCGG - Exonic
1160990644 19:1859017-1859039 GCTCTCTGCACTCTGCAGGCTGG + Intronic
1161391968 19:4025740-4025762 GCTCTGAGCACTCTGCAGCAGGG - Intronic
1164017082 19:21262681-21262703 GCTCTGACCACTCTGGAGGCTGG + Intronic
1164509054 19:28882784-28882806 GCTCAGAGCAATGTGCCAGCTGG + Intergenic
1165069944 19:33249319-33249341 GCACAGTGCACTCTTCCGGCAGG - Intergenic
1167694882 19:51009504-51009526 GCTCTGCTCTCTCTGCTGGCAGG - Exonic
1168316822 19:55488248-55488270 GGGCACAGCACTTTGCTGGCTGG + Intergenic
925384716 2:3454180-3454202 GCAAAAAGCACTCTCCTGGCTGG - Intronic
927420727 2:22927624-22927646 GCTCAAAGCTCTCTGCTAGTTGG + Intergenic
927441015 2:23117941-23117963 GCTCAAAGCACACAGCAGGCAGG + Intergenic
928378743 2:30800426-30800448 GCTCAGAGAGCTCTGCTGATGGG + Intronic
931994240 2:67824420-67824442 GCGCAGAGCTCTGTGCTGGAGGG + Intergenic
932128578 2:69167452-69167474 GCTCAGAGCACTCCTTTGGGTGG + Intronic
932450082 2:71804001-71804023 TCTCAGAGAACTATGCAGGCAGG - Intergenic
932772285 2:74507305-74507327 GCGCGGAGCCCTCTGCTGGGCGG - Intronic
932795838 2:74695381-74695403 GCACAGAGCACTCCCCTGTCTGG + Intergenic
933241083 2:79920968-79920990 GTTCACAGCATTCTGCAGGCTGG + Intronic
935301605 2:101697886-101697908 GCTCGGGGCTCTCTGCCGGCCGG - Intronic
936251930 2:110874019-110874041 GCCCAGAGCACTGTGCTGGGTGG + Intronic
937884057 2:126888162-126888184 GCTCTGAGCCGTCTCCTGGCAGG - Intergenic
938073159 2:128318798-128318820 GCGGAGAGCGCTGTGCTGGCCGG - Intergenic
938650843 2:133381885-133381907 GCGCAGAGCTCCCTGGTGGCTGG - Intronic
939165867 2:138640687-138640709 GGGCAGAGAACTCTTCTGGCAGG - Intergenic
939674174 2:145051198-145051220 GCTCAGAGCTCTATGCTGACTGG + Intergenic
940057361 2:149526857-149526879 GCTCAGTGCACTCTGCACGCTGG - Intergenic
941904851 2:170710886-170710908 GCTCACAGCATTGTGCAGGCAGG + Intergenic
942560014 2:177210262-177210284 GCCGAGATCACGCTGCTGGCTGG - Intergenic
944135954 2:196399365-196399387 GCCCAGAGTAGTCTGCTGCCAGG - Intronic
946852726 2:223922743-223922765 AATCAGAGAACTCTGCTGGGAGG + Intronic
947601587 2:231454218-231454240 GCTCAGCTCACTCTGCTTCCCGG + Exonic
947919608 2:233857635-233857657 GCACAGTGCCCTCTACTGGCCGG + Intergenic
948231637 2:236353230-236353252 GCGAAGAGCCCTCTACTGGCAGG - Intronic
948616742 2:239204186-239204208 GCGCAGGGCATCCTGCTGGCCGG + Intronic
948825507 2:240571816-240571838 GGCCAGAGGACCCTGCTGGCAGG - Intronic
949050992 2:241897094-241897116 TGTCAGGGCACACTGCTGGCGGG + Intronic
1170580400 20:17694916-17694938 GTTCAAAGCCCTCTGCAGGCAGG - Intronic
1170812943 20:19688537-19688559 TCTCAATGCCCTCTGCTGGCCGG - Intronic
1170893663 20:20396046-20396068 GCCCAGAGCGCTCTGATGGATGG - Intronic
1172242538 20:33423006-33423028 GCTGAGAGCACTTTGAGGGCAGG + Intronic
1172428592 20:34872774-34872796 GCCCAGGGCGCTCTCCTGGCTGG + Exonic
1172902752 20:38346799-38346821 GCCCAGGGCACTCAGCTGGTGGG - Intronic
1174035167 20:47664227-47664249 GCTCAGAGGGCTCCGCTGGCAGG + Intronic
1174483504 20:50847136-50847158 GCTGAGATCACTCTACCGGCTGG - Intronic
1175353414 20:58342994-58343016 GCCCAGGGCACTCTGACGGCAGG - Intronic
1175401045 20:58700038-58700060 GCTCACAACAGGCTGCTGGCAGG + Intronic
1177867699 21:26532446-26532468 GATAAGAGCATTCTGCTGGATGG - Intronic
1178486367 21:33022181-33022203 CCTCCAGGCACTCTGCTGGCAGG + Intergenic
1179955947 21:44738697-44738719 GCTCAGAGGTCTCTGCAGGAAGG - Intergenic
1181804621 22:25367282-25367304 GCACAGCTCACACTGCTGGCAGG - Intronic
1183317052 22:37142579-37142601 TCTCAGATCTCTCTGCTGCCAGG + Intronic
1183583426 22:38738821-38738843 GCTCTGAGCACACTGAGGGCTGG - Intronic
1184224492 22:43121416-43121438 GCGCAGCCCACTCTGGTGGCTGG + Intronic
1184855371 22:47143640-47143662 GCTCAGGGGACCCTGCAGGCAGG - Intronic
1184919267 22:47594171-47594193 GCTCAGAGCACCCTGGGGACGGG + Intergenic
950810301 3:15644613-15644635 TCTCTGAGGACTCTGATGGCAGG - Exonic
951222509 3:20083748-20083770 GCTCAGTGGAGTCTGGTGGCTGG + Intronic
952203721 3:31158053-31158075 GGTGAGAGCACGGTGCTGGCAGG + Intergenic
953687405 3:45088773-45088795 GCAAACAGCACTCTGCTTGCAGG + Intronic
954509229 3:51106949-51106971 GGTCACAACACTCTGCTGGGTGG - Intronic
954631757 3:52051627-52051649 GCTCAGCGCCCGCTGCTGCCAGG + Intronic
954709939 3:52500558-52500580 GCTCAGAGCAGAGTGGTGGCTGG + Intronic
955303018 3:57801421-57801443 GCTACCAGCACTCTGCTAGCTGG + Intronic
958481226 3:94648093-94648115 GCTCAGTGCACTCTGAGTGCGGG + Intergenic
962310835 3:134325887-134325909 GGTGAGAGCACTCTCCTGCCAGG + Intergenic
962635589 3:137327990-137328012 GGTCAGAGGACTCTGATGCCTGG + Intergenic
963389275 3:144637106-144637128 GATGACAGCACTCTGGTGGCAGG + Intergenic
965042224 3:163523742-163523764 GCACAGAACTCGCTGCTGGCTGG + Intergenic
965955201 3:174361310-174361332 TATCAGAGAACTCTGCTGTCTGG - Intergenic
966568011 3:181404677-181404699 TCTCAGAGCAGTCTGCTGCAGGG - Intergenic
968394117 4:217465-217487 TCACAGAGCACTCTGCTGGGAGG - Intergenic
971153671 4:24060015-24060037 GCTCAGTGCTCTCTGGTGCCTGG - Intergenic
972341335 4:38155046-38155068 TCCCGGAGCTCTCTGCTGGCTGG + Intergenic
972469958 4:39394861-39394883 GCTGAGAGCCCTCTTCTGGTTGG + Intergenic
973284860 4:48403700-48403722 GCCCAGAGAACACTGCTGCCTGG + Intronic
976125434 4:81829184-81829206 GCTGAGGGCAGTCAGCTGGCAGG + Intronic
976125438 4:81829210-81829232 GCACAGAGCTCCCTGCTGCCAGG - Intronic
978241402 4:106521021-106521043 GTTCACAGCACTCTGATGGGTGG + Intergenic
978296479 4:107211122-107211144 GCTCTGAGCACTGTGCAGACTGG - Intronic
985721741 5:1493161-1493183 GCTCACTGCACTCGGCTGGCTGG - Intronic
986009487 5:3699416-3699438 GCTCTGAGCGCTCTGCAGGGGGG + Intergenic
986105884 5:4658954-4658976 GCTCAGACCCCTGTCCTGGCTGG + Intergenic
986646580 5:9921921-9921943 GCTCAGAGCACACTGAAGGCTGG + Intergenic
987235319 5:15936404-15936426 GCTCAGAGCAACCTGCCAGCAGG - Intronic
991073406 5:62512037-62512059 CCACAGAGCACTCATCTGGCTGG + Intronic
991497701 5:67243644-67243666 GCTCAGAGCAGTGAGCTGGAAGG + Intergenic
994157598 5:96521310-96521332 GCACACAGTACTCTGCAGGCTGG + Intergenic
995859309 5:116624955-116624977 TCTCAGATCACCCTGCTGGATGG + Intergenic
997283130 5:132660929-132660951 GCTGAGAGCTGGCTGCTGGCTGG - Exonic
997411928 5:133697178-133697200 GCTGAGCCCACACTGCTGGCAGG + Intergenic
998376783 5:141696240-141696262 GCTCAGCCCTCTTTGCTGGCTGG + Intergenic
998621463 5:143799017-143799039 ACTCTGAGCACTGTGCTGGGAGG - Intergenic
999132437 5:149294756-149294778 GCCCAGAGCACTCCACTGGAGGG + Intronic
1000393728 5:160751022-160751044 GCACAGGGCACACTGCAGGCAGG - Intronic
1000650279 5:163809467-163809489 TTTCAGAGCACTCTGCTGATAGG - Intergenic
1001168835 5:169397184-169397206 GCTGAGAGCTCTCTGTTGGCAGG - Intergenic
1006063440 6:31442617-31442639 GGTCACAGCACTCGGCTTGCTGG + Intergenic
1006191486 6:32212478-32212500 GCTCAGTGCAGCCTTCTGGCAGG + Exonic
1007282408 6:40722269-40722291 GCTCAGAGCATTCCTCAGGCAGG + Intergenic
1007282444 6:40722529-40722551 GCTCAGAGTTCTATGCTGCCAGG + Intergenic
1007419635 6:41711885-41711907 GCTCAGAGGCCTCTTCAGGCTGG + Intronic
1007776924 6:44229102-44229124 GCTCGGGGGACTCTGCAGGCTGG - Intronic
1015256276 6:131183078-131183100 ACACAGAGCCCTCTGCTGGATGG - Intronic
1017032162 6:150233839-150233861 GCTCAGAGCACGCACCAGGCAGG + Intronic
1017590509 6:155974134-155974156 GCTAAGACCACCCTGCTGCCTGG - Intergenic
1023822797 7:43989250-43989272 GCCCAGGGCACTCTGCGTGCAGG + Intergenic
1028331900 7:89605214-89605236 GCTGAGAGTGCTCGGCTGGCAGG + Intergenic
1029769014 7:102641776-102641798 GCCCAGGGCACTCTGCGTGCAGG + Intronic
1030675767 7:112384078-112384100 GCTCACAGCACTCGCCTGGTTGG - Intergenic
1031986537 7:128167669-128167691 GCTCGGCGCAGTCTGCGGGCGGG + Intergenic
1034235693 7:149567331-149567353 GCACAGAACGCTCTGCTGGCAGG - Intergenic
1035670351 8:1412233-1412255 GCTCAGAGCAGGAGGCTGGCGGG - Intergenic
1037681378 8:21100531-21100553 GCTGACAGCAGTGTGCTGGCTGG + Intergenic
1037951262 8:23019830-23019852 GCCCAGAGAACTCTCCTGGGAGG + Intronic
1038213149 8:25538867-25538889 GCCCAGATCACACTGATGGCGGG + Intergenic
1039848088 8:41340350-41340372 GAACAGAGGACTCTGCTGGAAGG - Intergenic
1041405725 8:57497181-57497203 GCTCAAAGCACTCTGCATTCTGG - Intergenic
1043480164 8:80644727-80644749 CCACAGAGCACTCATCTGGCTGG + Intronic
1047218162 8:122896021-122896043 GCTAGGAGCTCTCTGCTGACAGG + Intronic
1048336700 8:133507873-133507895 GCCCAGAGGCCTCTTCTGGCTGG + Intronic
1048843893 8:138588602-138588624 GCTTAGAGCACTGAGGTGGCTGG + Exonic
1049106289 8:140615481-140615503 GCTCAGAGCCCTCTGAAGGGTGG + Intronic
1049312042 8:141938455-141938477 GCTCAGCCCTGTCTGCTGGCTGG - Intergenic
1049749574 8:144276856-144276878 TCTCTGGGCCCTCTGCTGGCTGG - Intronic
1053535836 9:38924774-38924796 ACTCAGAGCACTCTCCAGACAGG - Intergenic
1054208059 9:62149187-62149209 ACTCAGAGCACTCTCCAGACAGG - Intergenic
1054630296 9:67439163-67439185 ACTCAGAGCACTCTCCAGACAGG + Intergenic
1054803897 9:69379833-69379855 GCTCAGAGCACACTGCTGGATGG - Intronic
1055640726 9:78316808-78316830 CCACAGTGCTCTCTGCTGGCTGG + Intronic
1057429418 9:94980259-94980281 GGTCAGAGGACCCTGCAGGCTGG + Intronic
1059353907 9:113685225-113685247 TCTCAGATCCCTCTGCTTGCTGG + Intergenic
1060445839 9:123687243-123687265 GTTCAGAGCTCTCTGATCGCTGG - Intronic
1062084890 9:134643311-134643333 GCTCAGAGCTGTGTGCTGCCAGG + Intronic
1185577783 X:1187314-1187336 GTTCAGTGCACTCTGGTGGCTGG + Intergenic
1185769396 X:2754001-2754023 GTTCTGAGCACTCTGAAGGCAGG + Intronic
1188478957 X:30617876-30617898 CCACAGAGCACTCATCTGGCTGG - Intergenic
1189234466 X:39476836-39476858 GCTCAGTCCTCCCTGCTGGCTGG + Intergenic
1189680707 X:43513110-43513132 GCTGAGATCCCTATGCTGGCTGG - Intergenic
1198890655 X:141392115-141392137 GGTCACAGCACTCTGATGGGTGG + Intergenic
1200779560 Y:7201961-7201983 GCTCTGACCACTCTGGAGGCTGG + Intergenic
1201226645 Y:11825025-11825047 GCTGAGATCATTCTCCTGGCAGG - Intergenic