ID: 1070969554

View in Genome Browser
Species Human (GRCh38)
Location 10:80552293-80552315
Sequence CTGGGCTTTTGGCAGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070969554_1070969559 -7 Left 1070969554 10:80552293-80552315 CCCAGCTGCTGCCAAAAGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1070969559 10:80552309-80552331 AGCCCAGGGACTGTTTGAACAGG No data
1070969554_1070969563 22 Left 1070969554 10:80552293-80552315 CCCAGCTGCTGCCAAAAGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1070969563 10:80552338-80552360 TTTTGCTCCACTTTGCATGGAGG No data
1070969554_1070969562 19 Left 1070969554 10:80552293-80552315 CCCAGCTGCTGCCAAAAGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1070969562 10:80552335-80552357 GACTTTTGCTCCACTTTGCATGG No data
1070969554_1070969564 23 Left 1070969554 10:80552293-80552315 CCCAGCTGCTGCCAAAAGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1070969564 10:80552339-80552361 TTTGCTCCACTTTGCATGGAGGG No data
1070969554_1070969565 26 Left 1070969554 10:80552293-80552315 CCCAGCTGCTGCCAAAAGCCCAG 0: 1
1: 0
2: 0
3: 27
4: 312
Right 1070969565 10:80552342-80552364 GCTCCACTTTGCATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070969554 Original CRISPR CTGGGCTTTTGGCAGCAGCT GGG (reversed) Intronic
900466253 1:2826902-2826924 CTGGGTGTCTGGCTGCAGCTCGG + Intergenic
900632736 1:3645557-3645579 CTGGGCTGCTGGCTGCACCTCGG - Intronic
900695761 1:4009333-4009355 TTGGGCTTTTGGTAGAAGCCAGG - Intergenic
901157111 1:7148470-7148492 CTGGGCTTTTGGAAAGAGCCAGG + Intronic
901217379 1:7562369-7562391 CAGGGCTGGTGGCAGCAGCAGGG + Intronic
901455965 1:9362994-9363016 CTGGGTTTGTGGCTGGAGCTGGG + Intronic
901629401 1:10640924-10640946 CTGTGCCTCTGGCAGGAGCTGGG - Intronic
901838770 1:11940671-11940693 CTGGACTTTGGGCAGTAGGTGGG + Intronic
902638591 1:17751312-17751334 CTGGGCTGCTGGGAGCAGCTTGG + Intergenic
902779172 1:18693444-18693466 CGTGGTTTTTGCCAGCAGCTGGG - Intronic
903340590 1:22651972-22651994 CTGGGCTTGTGGATGCAGCTTGG - Intergenic
903470998 1:23587415-23587437 CTGGGCTGTTGGAAGCAGGTTGG + Intronic
903501072 1:23800481-23800503 CTGGGCTTTGGGCTGTAGCGCGG + Intronic
903845644 1:26278479-26278501 TTGGGCTGTTGGCAGCATCTTGG + Exonic
904316651 1:29670309-29670331 CAGGGCTCTTGGCTGCAGTTGGG + Intergenic
904611114 1:31726893-31726915 CTGGGCTGTGGGAAGCAGATTGG - Intergenic
905164671 1:36072731-36072753 CTGGGCATGTGGCTGGAGCTCGG + Intergenic
905225076 1:36473615-36473637 CTGGACTATTGGCAGGAGCCGGG - Exonic
905909810 1:41646049-41646071 CTGGGCTTATGGGAGATGCTCGG + Intronic
907450094 1:54540904-54540926 ATGGGGCTTTGGCAGCAGCCTGG - Intergenic
907555159 1:55337055-55337077 CTGGCCTCTGGACAGCAGCTCGG - Intergenic
910154981 1:84206672-84206694 CTGGGATTTTGGCATGTGCTAGG - Intronic
910585869 1:88878948-88878970 CTGGGCAGTTGGCACCGGCTGGG - Intronic
911752111 1:101507352-101507374 CTAGGAATTTGGGAGCAGCTTGG + Intergenic
912516035 1:110217097-110217119 CTTGGCTTTTGTCAGGAGCATGG - Intronic
913533482 1:119749634-119749656 CTGGGATATTGGCAGGTGCTAGG - Intronic
915621770 1:157090541-157090563 CTGGGCGTTTAGCAGCATCTGGG - Intergenic
917961071 1:180145107-180145129 CTAGCCTTCTGGAAGCAGCTGGG + Intergenic
919513830 1:198496984-198497006 CTGTGCCTATGCCAGCAGCTGGG - Intergenic
919553944 1:199028448-199028470 CAGAGATTCTGGCAGCAGCTGGG - Intergenic
919584688 1:199421876-199421898 CTGACCTTTAGGCAGGAGCTAGG - Intergenic
919817082 1:201448436-201448458 CTGGGCGTTTGGCAGGAGCCCGG - Intergenic
920448871 1:206041818-206041840 CTGGGCTTCTGGCAGTTTCTCGG - Intronic
921176498 1:212599796-212599818 TTTGGATTTTGGCAGAAGCTTGG - Intronic
921674877 1:217966034-217966056 CTGGCCTTGTGGCAGCATCTGGG + Intergenic
922668408 1:227491571-227491593 ATGGGCTCCTGGAAGCAGCTAGG - Intergenic
924243412 1:242060626-242060648 CTGGGCTTTGGGCAGCTACGTGG + Intergenic
1062939444 10:1410372-1410394 CTGTGCTCGTGGCAGCAGCGAGG - Intronic
1067815971 10:49477080-49477102 CTGGGCTTGTGGAAGATGCTGGG - Intronic
1070493779 10:77002070-77002092 CTGGGCATTAGGCAGAGGCTGGG + Intronic
1070529636 10:77325450-77325472 CTGGGCTTTGGGCTACAGCTTGG + Intronic
1070608279 10:77914838-77914860 CTGGGCTTTGGGCCACAGTTGGG - Intronic
1070664609 10:78334166-78334188 CTGAGCAGTAGGCAGCAGCTTGG + Intergenic
1070969554 10:80552293-80552315 CTGGGCTTTTGGCAGCAGCTGGG - Intronic
1072780628 10:98248881-98248903 CTGGTGTATCGGCAGCAGCTAGG + Exonic
1072799054 10:98379653-98379675 CTGACCACTTGGCAGCAGCTTGG - Intergenic
1074289901 10:112130635-112130657 ATGGGCTTCATGCAGCAGCTGGG + Intergenic
1075796504 10:125123827-125123849 CTGGGCAGCTGGCAGCACCTGGG - Intronic
1076065110 10:127442342-127442364 CTGGGCTTGGGGCTGCGGCTGGG - Intronic
1076615412 10:131751430-131751452 CTGTGCGTGTGGCAACAGCTAGG - Intergenic
1076799041 10:132812258-132812280 GGGGGCTTTTGGCAGGAGGTGGG - Intronic
1076881719 10:133242636-133242658 CTGTGCTTGTGGGGGCAGCTGGG - Intergenic
1077026671 11:442704-442726 CTGGGCTGAGGGCGGCAGCTGGG + Intergenic
1077396960 11:2329202-2329224 CTGCTCTCTTGGCAGCAGCTGGG + Intergenic
1077632967 11:3823651-3823673 CTGGGATTTGTGCAGCAGCATGG - Intronic
1077680107 11:4231788-4231810 CTGGGCTTTTGAGACCAGCCTGG + Intergenic
1077681382 11:4244117-4244139 CTGGGCTTTTGAGACCAGCCTGG - Intergenic
1078112503 11:8408964-8408986 CTGGGATTTTGGTAGATGCTAGG - Intronic
1078438542 11:11345226-11345248 TTGGGTTCTTGGCAGCATCTGGG + Intronic
1078739152 11:14050580-14050602 CTGGGCTTTTAGAAGAACCTAGG - Intronic
1078827053 11:14939407-14939429 GTAGGCTTTTGGAAGCAGCCAGG + Intronic
1079991725 11:27253443-27253465 CTGTGGTTTTGGCAGTGGCTGGG - Intergenic
1081011055 11:37812597-37812619 CTGGGCTTGCAGCAGCACCTGGG + Intergenic
1081568475 11:44275277-44275299 CTGGGCTCTTGGCTGCAGTTGGG - Intronic
1082803366 11:57430786-57430808 CTGGGCTTAAGGCAGGGGCTTGG + Intergenic
1083257224 11:61504095-61504117 CTGGGACTTTGGGAGCAGCAAGG - Intergenic
1083636213 11:64122394-64122416 CTGGGAAGATGGCAGCAGCTAGG + Intronic
1083678874 11:64342305-64342327 CTGGGAGTCTAGCAGCAGCTCGG - Exonic
1083855566 11:65391332-65391354 CTGGGCTGTAGGCAGCAGGAAGG + Intronic
1084627941 11:70323282-70323304 CTGGTCTTATGGCGGCAGCCAGG + Intronic
1084941918 11:72617588-72617610 CTGGGGTTTGGGGAACAGCTGGG - Intronic
1085123252 11:73980925-73980947 CTTGTCTTTGGGCAGCAGCTGGG - Intronic
1085252371 11:75152338-75152360 CTGGGCTTCTGGGAGCAAGTGGG - Intronic
1085705251 11:78781460-78781482 CTGAGCTTTTGGCATGAGGTTGG + Intronic
1086514674 11:87597976-87597998 CTGGGCTGGTGCCTGCAGCTGGG + Intergenic
1088831492 11:113540544-113540566 CTGGGCTTTTCCCAGCCTCTAGG - Intergenic
1088975511 11:114812959-114812981 CTGGGCTTATGGCTGCACCCTGG + Intergenic
1090384296 11:126347711-126347733 CTGGGGTCTTGGCAGGAGGTTGG + Intergenic
1091194478 11:133719631-133719653 CTGGGGTTGCGGCAGGAGCTGGG + Intergenic
1091540636 12:1458097-1458119 CTGGGCATTTGGCAGGACCATGG + Intronic
1091671577 12:2455982-2456004 CTGCGCTTTTGTCTCCAGCTTGG + Intronic
1092535923 12:9386976-9386998 CTGGGATTTTGGCAGGAATTGGG + Intergenic
1092881716 12:12892118-12892140 AAGGGCTTTTTGCAGCATCTGGG - Intronic
1093147699 12:15586499-15586521 CTGTGCTGTTAGCAGCAACTGGG + Intronic
1093476248 12:19557963-19557985 CTGGCCTTGTGGCATGAGCTTGG + Intronic
1095542973 12:43331830-43331852 CTGGGCTTTTTTCAGCTGGTAGG + Intergenic
1096463716 12:51836925-51836947 GGGGGTTTCTGGCAGCAGCTGGG - Intergenic
1097609006 12:61794620-61794642 CTGGGCTTTTGGTGTCAGTTAGG - Intronic
1098208758 12:68140029-68140051 CTGGGTTATTGGAAGCAGCATGG + Intergenic
1099713810 12:86264830-86264852 CTGGGTTTGTGACAGCACCTGGG - Intronic
1100029260 12:90165892-90165914 CTAGGATTATGACAGCAGCTAGG - Intergenic
1102914858 12:116745097-116745119 CTGGGCTTTTGGAGCCAGCAGGG + Intronic
1103021100 12:117534878-117534900 CTTGCCTTTTGCCAGCATCTAGG - Intronic
1103192662 12:119015480-119015502 CTGGGGCTTTGACAGGAGCTTGG - Intronic
1104763132 12:131309987-131310009 CTGGGCTGCTGACAGAAGCTGGG + Intergenic
1104963228 12:132497975-132497997 GTGGTCGTGTGGCAGCAGCTGGG + Intronic
1105353012 13:19633263-19633285 CTGGGGTTTCGGCAGCAGCAGGG + Intergenic
1105772087 13:23621390-23621412 CTGGGCTCTTGCTAGCACCTTGG - Intronic
1107123369 13:36819305-36819327 CCGGGCTTTTAGCACCTGCTTGG - Exonic
1107586539 13:41855251-41855273 CTTGGCTGTTGGCGGCAGCAAGG + Intronic
1108004707 13:45934914-45934936 CTGAGACTTTGGCAGAAGCTTGG + Intergenic
1108573047 13:51769099-51769121 CAGGGCTAGGGGCAGCAGCTGGG - Intronic
1108815336 13:54283953-54283975 CTGGGCTTTTTGCAGTTGGTAGG + Intergenic
1114455274 14:22849733-22849755 CAGGGCTCCTGGCACCAGCTGGG + Intergenic
1115310684 14:31975092-31975114 CTGGGTCATGGGCAGCAGCTGGG + Intergenic
1115931972 14:38507676-38507698 CTGTGATTTTGGCAGTGGCTTGG + Intergenic
1116876565 14:50118105-50118127 CTGGCCTTTTGGCAGCACTGAGG + Exonic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1117582989 14:57171742-57171764 CTGTGCTTTTGCAAGCAGTTGGG - Intergenic
1120804625 14:88733528-88733550 TTGTCCTATTGGCAGCAGCTAGG + Intronic
1120987860 14:90349930-90349952 CTGTGCTTTTGGCAGCATGTTGG - Intergenic
1121445626 14:93977098-93977120 CTGAGCTTGTGGCAGCATTTGGG + Intergenic
1122183698 14:99972710-99972732 CCGGGCTTCTGGCAGAAGCAAGG - Intronic
1124249561 15:28097870-28097892 CTGGGGGGTTGGGAGCAGCTGGG - Intronic
1124683307 15:31756058-31756080 CTGGGCAAGGGGCAGCAGCTGGG - Intronic
1125530165 15:40407936-40407958 CAGGAATTTTGGAAGCAGCTGGG + Exonic
1129223834 15:74153854-74153876 TTGGGCATGGGGCAGCAGCTGGG - Intergenic
1131022316 15:89109282-89109304 TTGGGCATTTGGTAGCACCTTGG + Intronic
1131308343 15:91265637-91265659 CTGAACTCTTGGCTGCAGCTGGG - Intronic
1131566216 15:93487870-93487892 CAGGGCTTTTCCCAGCAGGTTGG + Intergenic
1132155617 15:99493492-99493514 CTGGGTTCTTGGCTGCACCTGGG + Intergenic
1132198973 15:99934774-99934796 CTGGGCTTTTGCTACCAGTTGGG + Intergenic
1133418067 16:5621918-5621940 AGTGGCTTTTGGCAGCTGCTTGG - Intergenic
1133739618 16:8641280-8641302 ATGGGACTGTGGCAGCAGCTGGG - Intronic
1134248136 16:12555198-12555220 CTGGACTATGGGCAGCTGCTGGG + Intronic
1135108706 16:19673365-19673387 CTGGCCAGTTGGCTGCAGCTGGG + Intronic
1135719957 16:24807888-24807910 CTGGGCTGTGGGCAGAGGCTGGG + Intronic
1136531835 16:30875158-30875180 CTGGGCTGTGGGCAGCATCGTGG - Intronic
1138386414 16:56638510-56638532 CTGGGCTTTGCGCAGCAGAAAGG - Intergenic
1138649433 16:58450799-58450821 TTGGGCTTTAGGCAGGAGTTTGG - Intergenic
1139743750 16:69057880-69057902 CTGTGCTTTTGGCAAGAGGTAGG - Intronic
1140616525 16:76671109-76671131 CTGGGAGGTTGGCAGCATCTAGG + Intergenic
1140816976 16:78630287-78630309 CTTGGCTCTTGGCTGCATCTGGG + Intronic
1143890430 17:10098297-10098319 GGTGTCTTTTGGCAGCAGCTGGG - Intronic
1144744061 17:17601381-17601403 CTGAGCTTTAGAAAGCAGCTTGG - Intergenic
1145741289 17:27276833-27276855 CTTGGCTTGGGCCAGCAGCTGGG + Intergenic
1145768166 17:27473538-27473560 CTGGGGTTTGGGCAGCAGGCAGG + Intronic
1145776926 17:27535650-27535672 CTGTGCCTTTGGCAGCTGATAGG - Intronic
1147477033 17:40721881-40721903 CAGGGCTGGAGGCAGCAGCTTGG - Intergenic
1148587998 17:48794569-48794591 CTGGGCTGTGGGCATCAGCTGGG - Intronic
1148957157 17:51363361-51363383 CTGGGCTGCTGACAGCTGCTGGG + Intergenic
1151712281 17:75813610-75813632 CTTGGCTTGTGGCACCAGCAAGG + Intronic
1152217527 17:79042419-79042441 CAGAGCTTTTGGCAAAAGCTTGG - Intronic
1152457951 17:80426880-80426902 CTGGGCTGCTGGAAGCAGCATGG - Intronic
1152775078 17:82196141-82196163 GGGGGCTCTTGGCAGCATCTGGG - Intronic
1152876164 17:82787358-82787380 CCGGGCTTCTGGCAGCTCCTGGG + Intronic
1153506294 18:5803022-5803044 GTAGGCTTTTAGGAGCAGCTGGG - Intergenic
1153659879 18:7317117-7317139 CTGGGGCTTTGGCAGAAGCAAGG - Intergenic
1155312326 18:24535943-24535965 CTTGGCTTTTTGCAAGAGCTGGG + Intergenic
1156364685 18:36414855-36414877 CTTGGCTTGTGGCAGCAGGAGGG + Intronic
1156503669 18:37575698-37575720 CCTGGCTTTTGGCTGCAGCCCGG + Intergenic
1157429574 18:47613714-47613736 GTGGCCTTTTGTCAGCAGCATGG + Intergenic
1157791715 18:50537759-50537781 CTGGGCAGGTGGCAGCAGCAAGG + Intergenic
1160882434 19:1327305-1327327 CTGGGCTTCCGGCTCCAGCTCGG - Intergenic
1161145655 19:2676623-2676645 CTGGGAGTTTGACACCAGCTTGG - Intronic
1161302411 19:3549002-3549024 CCTGGCTTTGGGCACCAGCTGGG + Intronic
1161445960 19:4319247-4319269 CTGGGATTTAGGGAGTAGCTGGG + Intronic
1162462348 19:10820609-10820631 CTCGGCCAATGGCAGCAGCTGGG - Intronic
1163420862 19:17212934-17212956 CTGGGCTATTGGCTGGAGCCAGG + Exonic
1164600903 19:29562637-29562659 CGGGGGTTTTGGCAGCACCAAGG + Intronic
1165130623 19:33629666-33629688 CTGGGCTGTTGCCTGCAGCTCGG - Intronic
1166837967 19:45678703-45678725 CTGGGCTGTGGGGAGCAGCAGGG + Intronic
1168238805 19:55079118-55079140 TAGGGCTTTTGAAAGCAGCTAGG + Intronic
1168469617 19:56629756-56629778 CTGGGCTTTGGGTAGCAGGGGGG - Intergenic
1168683838 19:58335989-58336011 CTGGCCTATTGGCAACAGATAGG + Intronic
924988697 2:293236-293258 CTGGGCCTGGGGCAGCAGCAGGG - Intergenic
926704271 2:15825821-15825843 CTGGGCTTTCGGCTGCTGCGAGG + Intergenic
928241571 2:29591369-29591391 CTTGGCTTTTGGAAGCATCCGGG + Intronic
929081521 2:38127175-38127197 TTAGGCTTTTGGAAGCAGCCAGG - Intergenic
931432012 2:62215816-62215838 CTGGGGTTTAGTCAGAAGCTTGG + Intronic
932309636 2:70729215-70729237 GTGGGCCTCTGGCAGAAGCTGGG - Intronic
932572562 2:72945693-72945715 CAGGGCTTCTGCCAGCAGCGTGG - Intronic
932756655 2:74414476-74414498 CAGGGCTTCTGGCAGCAACACGG + Exonic
933168236 2:79097574-79097596 CTGGGTTTTTGTCAGGACCTTGG + Intergenic
933778663 2:85786988-85787010 CTGGGCATCTGGCGGCATCTTGG - Exonic
936023908 2:109016680-109016702 CTTGGCTCTGGGCAGCAGGTAGG - Intergenic
938261388 2:129897404-129897426 CTGGGCTGTTGTCATCACCTGGG + Intergenic
938372133 2:130776744-130776766 ATGGGCTCTGGGCAGCAGCCAGG + Intergenic
938707853 2:133949033-133949055 CTCAGCCTTTGGCAGCACCTAGG + Intergenic
938937094 2:136136650-136136672 CTGGGCTTCTGGCAACAGTTTGG + Intergenic
939878623 2:147605190-147605212 TTGAGCCCTTGGCAGCAGCTGGG - Intergenic
940009996 2:149042349-149042371 CTGGACTTTTGGAATCAGATTGG + Intronic
940468559 2:154064023-154064045 CTGGGCTGCTGCCAGCAGATAGG - Intronic
945020286 2:205564170-205564192 CTGGGCTTTCTGCAGCATCAAGG + Intronic
946395747 2:219442885-219442907 CTGGGCTCTTGGGAGGAGCAGGG - Intronic
946644057 2:221814953-221814975 ATAGGCTTTTGGAAGCAGCCAGG - Intergenic
948135405 2:235632600-235632622 CTGGGGTCTTGGCAGCAATTGGG + Intronic
948302982 2:236922270-236922292 CAGTGCTTGTGGCAACAGCTTGG - Intergenic
948458302 2:238117373-238117395 CTGGGCTTGTGGCTGGAACTTGG + Intronic
948834771 2:240620624-240620646 CAGGGCCCTTGGCAGGAGCTGGG - Intronic
948853567 2:240719866-240719888 GTCGGCCTCTGGCAGCAGCTCGG + Exonic
1173554848 20:43958696-43958718 TTGGGCTTTTGACAGTAACTGGG + Intronic
1173905619 20:46626494-46626516 TTGGGGTTTTGGCAGCAAGTAGG + Intronic
1174264648 20:49322740-49322762 CTGGGATTTTGGCTGGAACTGGG - Intergenic
1174578920 20:51557076-51557098 CCAAGCTTTTGGCATCAGCTGGG + Intronic
1175543230 20:59761314-59761336 CTGGGCTCTGGGCAACTGCTGGG + Intronic
1175544928 20:59772010-59772032 CTGGGCCTGTGCCAGCTGCTAGG + Intronic
1175925271 20:62468390-62468412 CTGTGCCCTTGGCAGCAGCCTGG - Intronic
1179308034 21:40172639-40172661 CTTGGCTTTAGCCAGCATCTTGG + Intronic
1180722501 22:17920022-17920044 CTGGGCTTGTGGCAGCTTCGTGG - Intronic
1180951764 22:19723643-19723665 CTGGTCGTTTGGCTGCAGCTGGG + Intronic
1181436986 22:22916810-22916832 CTGGGGTTATGCCAGGAGCTTGG + Intergenic
1181446910 22:22984044-22984066 CTGTCCTTTTGGAAGCAGCAAGG + Intergenic
1181558450 22:23685563-23685585 CTGGGCTTTGGGTAGCTGTTGGG - Intergenic
1181693656 22:24581954-24581976 CTGGGTTGATAGCAGCAGCTAGG + Intronic
1181897253 22:26121441-26121463 CCTGGCTTTGGGCAGGAGCTAGG - Intergenic
1182755592 22:32676294-32676316 CTGGGTATTTGGAAGGAGCTGGG + Intronic
1183579576 22:38715889-38715911 CTGGGCTCTTGTCACCAGATGGG + Exonic
1185167852 22:49272668-49272690 CTGGGCTTTTCTGGGCAGCTCGG + Intergenic
1185259412 22:49853497-49853519 CTTGGCAGTTGGCAGCGGCTCGG - Intergenic
949577968 3:5357352-5357374 GTTGGCTTTTGACAGCAGCAGGG - Intergenic
950041669 3:9923710-9923732 CTTGGCTTTGGGCAGCTGCTAGG + Intronic
953636855 3:44671390-44671412 CTTGGCATTTGGTAGCAGCTGGG - Intergenic
953774412 3:45803320-45803342 CTGGACTGTGGGCAGCTGCTTGG + Intergenic
954117836 3:48476995-48477017 CTGGGGTTGTGGCAGCAGGGAGG - Intronic
954553864 3:51503443-51503465 ATGGGCTTGTGGGAGCACCTGGG - Intergenic
954563477 3:51578714-51578736 CTGGCCTCGTGGCAGCATCTAGG + Intronic
954803786 3:53203148-53203170 CTGGGCTTTTGGCCTCAGCGGGG + Intergenic
956082990 3:65579283-65579305 CTAGTTTTTTGGCAGAAGCTTGG - Intronic
956869985 3:73407267-73407289 TTGGACTTGTGGCAGCATCTTGG + Intronic
957924163 3:86787299-86787321 TTGGGGTTTTGCCAGCAACTAGG - Intergenic
961349177 3:126288009-126288031 CTAGGTCTTTGGCAGCGGCTGGG + Intergenic
961603862 3:128079275-128079297 GTTGGCATTTAGCAGCAGCTAGG - Intronic
961809138 3:129511637-129511659 CTGAGCTTCTGGCAGCCTCTAGG + Intronic
962626061 3:137227175-137227197 CTGGGATTTTGTCAAGAGCTTGG + Intergenic
962860152 3:139392066-139392088 CCTGCCTTTTTGCAGCAGCTGGG + Intergenic
962869749 3:139477720-139477742 TTGGCCTTTTGACAACAGCTGGG - Intronic
963931048 3:151004650-151004672 CTGGACTTTCAGCAGCAGGTTGG + Intergenic
964677974 3:159304910-159304932 ATGGGCTATTGTCAGAAGCTGGG - Intronic
965390082 3:168094794-168094816 CTGGGCCTTTGACAAGAGCTCGG + Intronic
965787693 3:172353177-172353199 CTGGGCTCTTAGAAACAGCTGGG - Intronic
966794353 3:183699082-183699104 CTGTGCTCTTTGCAGTAGCTTGG + Intronic
966937005 3:184717229-184717251 ATGGGCTGTTGGCAGCCCCTTGG - Intergenic
968831948 4:2936926-2936948 CTGGGCTGAAGCCAGCAGCTTGG - Intergenic
969976506 4:11108023-11108045 CTGGCCTCATGGCAGCATCTAGG + Intergenic
970113321 4:12663379-12663401 CTGGGCTCTTCTCAACAGCTTGG - Intergenic
970447585 4:16136953-16136975 CAGGGCTCCTGGCAGCAGATGGG - Intergenic
970856332 4:20652703-20652725 ATAGGCTTTTAGAAGCAGCTGGG + Intergenic
974721828 4:65749917-65749939 CTGGGCTATAGGCATCTGCTGGG + Intergenic
975041876 4:69755133-69755155 CTGTGCTTTTGCAAGCAACTGGG - Exonic
976300111 4:83508791-83508813 CTGGGTTTTTGTCAGGACCTTGG + Intronic
976745904 4:88402758-88402780 CTGTGCATTTGGGAGGAGCTAGG + Intronic
978866769 4:113522578-113522600 CAGGCCTTTTGGCAGCAGGCAGG + Intronic
979509693 4:121538206-121538228 AATGGCTTTTGGCAGCAACTTGG - Intergenic
979775287 4:124582275-124582297 ATAGGCTTTTAGAAGCAGCTGGG + Intergenic
980448289 4:132939781-132939803 CTAGGCTTTTAGAAGCAGCTGGG + Intergenic
980448665 4:132943626-132943648 GTAGGCTTTTAGAAGCAGCTGGG + Intergenic
983379052 4:166968121-166968143 ATAGGCATTTGGAAGCAGCTAGG - Intronic
985986534 5:3521114-3521136 CTGGGGATTTAGCTGCAGCTTGG + Intergenic
986099660 5:4595626-4595648 ATGGGCTTTTAGAAGCAGCCTGG - Intergenic
986168867 5:5299338-5299360 CTTGGCCCTAGGCAGCAGCTCGG + Intronic
986352899 5:6896410-6896432 ATGGGCCTTTGACAGGAGCTGGG + Intergenic
986525553 5:8670774-8670796 CTGGGCCTCTGGTAGCTGCTGGG - Intergenic
988725619 5:33923523-33923545 ATTGGCATTGGGCAGCAGCTGGG - Intergenic
990184964 5:53202379-53202401 CTGGGTTTTTGACAGGACCTTGG - Intergenic
990724642 5:58740226-58740248 TTGGGCTGTTGGCAGCATCCTGG + Intronic
990727165 5:58768721-58768743 CTGGCCTTTTTGCTGCTGCTTGG - Intronic
990841797 5:60089106-60089128 CTCCACTTTTGGCAGCAGATAGG + Intronic
992027160 5:72681569-72681591 CTGGGATTTGGTCACCAGCTGGG - Intergenic
992484315 5:77180544-77180566 CTGGGCTTGTGCCAGCGGCCGGG - Intergenic
993456374 5:88131697-88131719 GTAGGCTTTTGGAAGCAGCCAGG + Intergenic
995789724 5:115872386-115872408 CTGGGTTTTTGGGAGGAGCTGGG + Intronic
997964964 5:138349541-138349563 CAGGGACTTTGGCAGCAGGTGGG - Exonic
998567517 5:143229536-143229558 CTGTGCTTGTGGCAGAAGCTGGG - Intergenic
999242539 5:150136263-150136285 CTGGGCCTTGGGCAGAACCTGGG - Intronic
1001605582 5:172957892-172957914 CTGGGCTATTTGCAGAAGCCTGG - Intergenic
1001774116 5:174315893-174315915 CTGGGCTTCGGGCGGGAGCTGGG + Intergenic
1004175524 6:13336619-13336641 CTGGTCTTGTGGCAGAAACTCGG + Intergenic
1006728011 6:36213999-36214021 CTGGGCTTTAGGAACCTGCTTGG - Exonic
1006739997 6:36301347-36301369 CAGGGCTGTAGGCAGCAGCTAGG - Intronic
1007747560 6:44052263-44052285 TTGGGACTTTGTCAGCAGCTGGG - Intergenic
1007925148 6:45644269-45644291 CTGGGGTTGGGGGAGCAGCTGGG - Intronic
1008628720 6:53343871-53343893 CTGGGCTTCTTCCACCAGCTGGG - Intronic
1009784227 6:68311371-68311393 CAAGGCTTTTGGCAGGAGATTGG + Intergenic
1011640012 6:89409949-89409971 ATGGGCTTTTGGGATCAGCTTGG - Intronic
1013607304 6:111762197-111762219 CTGAGCTGTTGGCCACAGCTGGG + Intronic
1013967845 6:115976550-115976572 CTGGTCTTCTGGCATCATCTGGG + Intronic
1014345094 6:120259654-120259676 CTGGGCTTTATCTAGCAGCTAGG + Intergenic
1014514315 6:122362265-122362287 CTGGGATTGTGGCAGAACCTGGG - Intergenic
1016292249 6:142538523-142538545 CTGGGTTTTTGTCAGGACCTTGG - Intergenic
1016461779 6:144285942-144285964 CTGGGACTTGGGAAGCAGCTCGG - Intronic
1017729928 6:157306154-157306176 GTGGGCCTCTGGCAGCAGCATGG + Intronic
1017738341 6:157382460-157382482 CTGGGCTTCTGGGAGCAGGGAGG + Intronic
1017952066 6:159143638-159143660 CTGGACCTTTGGTAGGAGCTAGG + Intergenic
1018595993 6:165481204-165481226 CTAGAATTTTGGCAGCTGCTAGG - Intronic
1019260980 7:81874-81896 CTGTGCTGTGGGCAGAAGCTGGG - Intergenic
1019733408 7:2639237-2639259 CTGTGCGTATGGCAGCAGCACGG - Intronic
1022833985 7:34096315-34096337 CTGGTGTTCTGGCAGCAGCAGGG + Intronic
1023090874 7:36616157-36616179 CAGGGTTCCTGGCAGCAGCTGGG + Intronic
1023362831 7:39433168-39433190 CTGGGCGTTTGTGAGGAGCTGGG - Exonic
1023966849 7:44967281-44967303 CTGGGTTTTTGCCAAGAGCTGGG + Intronic
1024240994 7:47435741-47435763 GGGAGATTTTGGCAGCAGCTTGG - Intronic
1027948338 7:84780195-84780217 ATGTGCTTGTGGCAGCAGCATGG + Intergenic
1028458371 7:91062865-91062887 CTGGGCTTCTAGCTGCAGGTTGG + Intronic
1032096323 7:128940026-128940048 CAAGGCTTTTGCCTGCAGCTAGG - Intronic
1034285321 7:149880066-149880088 TTGGGCTTTTGGCTGCAGTGGGG + Exonic
1038369035 8:26969569-26969591 CTGGCCCTGTGGCAGCATCTGGG + Intergenic
1038620233 8:29135777-29135799 CTGAGCCTTTGGGAGTAGCTGGG - Intronic
1041414396 8:57591589-57591611 CTGTTCATTTGGCAGCTGCTGGG - Intergenic
1043483975 8:80680608-80680630 CTGATCTTTTGGCACCTGCTGGG - Intronic
1043530474 8:81144459-81144481 CTGGTTTTTTGGCAGTATCTTGG - Intergenic
1044398995 8:91748061-91748083 CAGAGCTCATGGCAGCAGCTTGG - Intergenic
1044448133 8:92302160-92302182 CTGGCCCTGTGGCAGCATCTAGG + Intergenic
1045485538 8:102628218-102628240 CTGGGCTTTGGGCCAAAGCTGGG - Intergenic
1049064811 8:140304754-140304776 TTGAGCTTTTGGCAGGAGTTGGG - Intronic
1049116671 8:140694666-140694688 CTTGGCCTTTGGCATGAGCTAGG - Intronic
1049270164 8:141691353-141691375 CTGAGCTCTTGGCAGCGGCCTGG + Intergenic
1049538060 8:143191707-143191729 CTGGGCACGGGGCAGCAGCTTGG + Intergenic
1049807523 8:144547679-144547701 CTGGGCCTGTGGCAGCGGCGTGG + Exonic
1049942308 9:558768-558790 CTGGTTTTTTGGCTTCAGCTGGG + Intronic
1050246220 9:3693100-3693122 CTGGGGGTTTGACACCAGCTTGG + Intergenic
1050552384 9:6758895-6758917 CGGGGCTGTAGGCAGGAGCTTGG + Intronic
1051925834 9:22323616-22323638 CTGGGTTTTTGACTGTAGCTGGG + Intergenic
1053007395 9:34613116-34613138 CTCGGCTCGTGGCAGCAGGTAGG + Intergenic
1053612816 9:39732440-39732462 CTGGGTGTTTGCCAGCAGGTTGG - Intergenic
1054240699 9:62609950-62609972 CTGGGTGTTTGCCAGCAGGTTGG + Intergenic
1054554833 9:66644474-66644496 CTGGGTGTTTGCCAGCAGGTTGG + Intergenic
1055449312 9:76416503-76416525 CTGGCCCTATGGCAGCATCTAGG - Intergenic
1056118737 9:83466031-83466053 CTGGGCTTCCTGCAGCACCTGGG + Intronic
1057185650 9:93056194-93056216 ATGGCCTTTTGGCAGCAAATGGG + Intergenic
1057518157 9:95738713-95738735 CTGGCCCTTTGGCTGCAGTTTGG - Intergenic
1058402771 9:104636812-104636834 CTGGGCTTGAGGCATCAGGTTGG - Intergenic
1059311317 9:113390692-113390714 CTGGGTTTTGGGGAGCACCTTGG + Intronic
1059453945 9:114387989-114388011 CTGGTCTGTGAGCAGCAGCTTGG - Intronic
1060146952 9:121261202-121261224 CTGGGCTTTCAGAAACAGCTGGG + Intronic
1060588691 9:124802521-124802543 CAGGGCTTGGGCCAGCAGCTGGG - Intronic
1061094098 9:128444472-128444494 CTGGGCGTATGGCAGCAGCCAGG + Intergenic
1062584919 9:137244921-137244943 CTGGGCTCCTGGAAGCAGCTGGG + Intronic
1186317451 X:8386216-8386238 TTGGGCTGTTGGCAGCACCCAGG - Intergenic
1187470985 X:19569627-19569649 CTGGGGTTGTGGCATCAGCCAGG + Intronic
1188721761 X:33530724-33530746 CTGATGTATTGGCAGCAGCTGGG + Intergenic
1189056024 X:37700389-37700411 ATGGGCTGATGGCAGCAGCCTGG - Intronic
1189565005 X:42232492-42232514 CTGGGGTTTTGAGAGCATCTGGG + Intergenic
1192197411 X:69037893-69037915 CTGGGTTTTTGGTACCAGCAAGG - Intergenic
1192533199 X:71907396-71907418 CTAGGTTCTTAGCAGCAGCTAGG + Intergenic
1195068847 X:101260742-101260764 TTGGGCTCTGGGCAGCAGCAGGG + Exonic
1195200847 X:102548431-102548453 CCGGGGTTCCGGCAGCAGCTCGG - Intergenic
1199520524 X:148730244-148730266 CTAGGATTTTTGCAGCAGATTGG + Intronic
1199696171 X:150344036-150344058 CAGTGCAATTGGCAGCAGCTGGG + Intergenic
1200087851 X:153618501-153618523 CAGGGCTTTTGACAGCTCCTGGG - Intergenic