ID: 1070971043

View in Genome Browser
Species Human (GRCh38)
Location 10:80567548-80567570
Sequence TATAGTGCCTTAGGGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070971043_1070971048 -6 Left 1070971043 10:80567548-80567570 CCTGTCACCCCTAAGGCACTATA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1070971048 10:80567565-80567587 ACTATATACAGTGCTGGAGCAGG No data
1070971043_1070971050 13 Left 1070971043 10:80567548-80567570 CCTGTCACCCCTAAGGCACTATA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1070971050 10:80567584-80567606 CAGGGTCAGAATACCCACTAAGG No data
1070971043_1070971049 -5 Left 1070971043 10:80567548-80567570 CCTGTCACCCCTAAGGCACTATA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG No data
1070971043_1070971052 26 Left 1070971043 10:80567548-80567570 CCTGTCACCCCTAAGGCACTATA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1070971052 10:80567597-80567619 CCCACTAAGGAAATGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070971043 Original CRISPR TATAGTGCCTTAGGGGTGAC AGG (reversed) Intronic
903603539 1:24558666-24558688 CATAGTGTGTTAGAGGTGACAGG + Intronic
915146406 1:153798210-153798232 TTGAGTGCATTAGGGGTGAATGG - Intergenic
918523654 1:185442104-185442126 TACAATGTCTTGGGGGTGACAGG - Intergenic
920758879 1:208762440-208762462 TATAGTGCATTCGGGGAGACAGG + Intergenic
922021654 1:221711053-221711075 TATAGTTCTTTAGGGGTGCTAGG - Intronic
1063256745 10:4336740-4336762 TAAAGTGCCCTTGGAGTGACTGG - Intergenic
1070971043 10:80567548-80567570 TATAGTGCCTTAGGGGTGACAGG - Intronic
1083688142 11:64389931-64389953 TATGGTGTCCTTGGGGTGACAGG - Intergenic
1085386495 11:76161080-76161102 TAGAGACCCTTAGAGGTGACGGG + Intergenic
1088786809 11:113189649-113189671 CATTGTGCCTTGGGGGTGAGGGG + Intronic
1091647129 12:2282335-2282357 TCTAGTGCCTTTGGGCTCACAGG - Intronic
1092310960 12:7352166-7352188 TATAGTTCCTTTAGGGAGACAGG - Intronic
1117458825 14:55924841-55924863 TATGGTGGCTTAGAGGAGACAGG + Intergenic
1126462530 15:48928605-48928627 TTTAGTGTCTTGGGGGTGAGAGG + Intronic
1131003411 15:88956270-88956292 TGTAGAGCCTTAGGGGTTACAGG + Intergenic
1132808216 16:1785584-1785606 TTTATTGCCCCAGGGGTGACCGG + Intronic
1134515619 16:14884569-14884591 TCTCGTGCCTTAGGTGTGACAGG + Intronic
1134647752 16:15883893-15883915 GATAGTGCCATCTGGGTGACTGG - Intronic
1134703292 16:16283213-16283235 TCTCGTGCCTTAGGTGTGACAGG + Intronic
1134964251 16:18428901-18428923 TCTCGTGCCTTAGGTGTGACAGG - Intronic
1134968538 16:18511437-18511459 TCTCGTGCCTTAGGTGTGACAGG - Intronic
1136268489 16:29134246-29134268 TATGCTCCCTTAGGGGTGGCTGG - Intergenic
1138643314 16:58403760-58403782 TATGGTGCATTACAGGTGACAGG + Intronic
1142071799 16:88094583-88094605 TATGCTCCCTTAGGGGTGGCTGG - Intronic
1143516703 17:7422854-7422876 TATAGGACCTTCAGGGTGACTGG - Intergenic
1153359716 18:4180378-4180400 TGTAATGTCTTTGGGGTGACTGG - Intronic
1156181005 18:34604155-34604177 TAAGGTGGCTTAGGCGTGACCGG + Intronic
1158043015 18:53119742-53119764 ATTAGTGCCTAAGAGGTGACTGG - Intronic
1159714520 18:71805249-71805271 AATAGTGTCTTCGGTGTGACTGG + Intergenic
1168127982 19:54297675-54297697 TATTGAGCCTTAGGAGAGACTGG + Intergenic
925058240 2:871802-871824 TCCAGTCCCTGAGGGGTGACAGG - Intergenic
927154118 2:20212070-20212092 TAAAGTGCTTTACGGCTGACAGG + Intronic
927482825 2:23467973-23467995 TATAGTGCCATGGGGATGGCTGG - Intronic
932620158 2:73260400-73260422 AGTAGGGCCTTAGGGGTGACGGG + Exonic
942818752 2:180084685-180084707 TATAGTGACATAAGGGTTACTGG - Intergenic
943591834 2:189808010-189808032 TATATTGCCTTAGTGCTGATAGG + Intronic
944220513 2:197299724-197299746 TACAGTTCTTTAGTGGTGACAGG + Intronic
947808325 2:232983409-232983431 TTTGGTGCCTGAGGGGTGAATGG + Intronic
948350171 2:237333823-237333845 AATAGAGCCCTAGGGTTGACTGG + Intronic
1173980467 20:47220124-47220146 TATGGATCCTTAGGGGTGCCTGG - Intronic
1182006762 22:26966815-26966837 TGTAGTGCTTTAAAGGTGACAGG - Intergenic
1183583191 22:38737701-38737723 TCTGGTTCCTTAGGGCTGACAGG - Intronic
953837849 3:46362639-46362661 AATGGGGCCTTAGGGTTGACTGG + Intergenic
954148320 3:48645286-48645308 TATTGTGGTTTAGGGGTGAGAGG - Intronic
955245916 3:57225007-57225029 GAGAATGCCTTAGGGGTTACTGG - Intronic
960213684 3:115003265-115003287 TATAGTACATTAGGGTTCACTGG - Intronic
967158248 3:186712868-186712890 TATGGTGCCTTAAGGGAGAAAGG + Intergenic
967370072 3:188734600-188734622 TTCAGTGTCCTAGGGGTGACTGG + Intronic
971440775 4:26682621-26682643 TAAAGTGCCTGAGAGGTGAAAGG + Intronic
980664943 4:135920635-135920657 TATTGTGCCTTAGCAGTTACTGG + Intergenic
981499708 4:145436928-145436950 TGTAGTGCCAGAGGGGTCACTGG - Intergenic
982652355 4:158101948-158101970 TCTAGTCCCTGAGGGGTGACTGG - Intergenic
983287690 4:165760502-165760524 AAGAGTGGGTTAGGGGTGACGGG + Intergenic
998019233 5:138755568-138755590 TATAGTGACTTAGAGATGAGAGG + Intronic
998918195 5:147039206-147039228 TACAGTGACTGAGGGGTGATGGG - Intronic
1001755441 5:174165073-174165095 AATCGTGCCTTTGGAGTGACTGG + Intronic
1004552985 6:16667664-16667686 TGTGGTGCCTTAGAGATGACTGG - Intronic
1007081568 6:39108839-39108861 GATAGTGAATTAGGGGTGAGGGG - Intronic
1009743612 6:67782720-67782742 TCTAGTGCTTTAGAGGTGAAAGG - Intergenic
1012085429 6:94819844-94819866 TATAGGCTTTTAGGGGTGACAGG - Intergenic
1019935070 7:4249453-4249475 CCTAGTGCCTTTTGGGTGACAGG + Intronic
1020979290 7:15047376-15047398 TATTGTGCCTCAGTGGTGTCTGG - Intergenic
1043376874 8:79659479-79659501 CATAGTGCGTTAGGGGAGAAAGG - Intronic
1051800680 9:20930010-20930032 TCTAGTGCCTAAGGGGTGTTGGG + Intronic
1057150728 9:92793846-92793868 AAAAGGGCCTTAGGGGAGACGGG + Intergenic
1059154008 9:111974029-111974051 TACAGTGCTTTAGGAGTGCCTGG + Intergenic
1059913519 9:119073409-119073431 TATAGTCAATTAGGAGTGACAGG - Intergenic