ID: 1070971049

View in Genome Browser
Species Human (GRCh38)
Location 10:80567566-80567588
Sequence CTATATACAGTGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070971043_1070971049 -5 Left 1070971043 10:80567548-80567570 CCTGTCACCCCTAAGGCACTATA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1070971049 10:80567566-80567588 CTATATACAGTGCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070971049 Original CRISPR CTATATACAGTGCTGGAGCA GGG Intronic
No off target data available for this crispr