ID: 1070976288

View in Genome Browser
Species Human (GRCh38)
Location 10:80608525-80608547
Sequence CAGTGTAGCCCGAGTGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070976283_1070976288 18 Left 1070976283 10:80608484-80608506 CCTGTCACGTGTCGTGTGCTGCC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1070976288 10:80608525-80608547 CAGTGTAGCCCGAGTGCAGGGGG No data
1070976284_1070976288 -3 Left 1070976284 10:80608505-80608527 CCAGCTCTTAACTATGCTTTCAG 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1070976288 10:80608525-80608547 CAGTGTAGCCCGAGTGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070976288 Original CRISPR CAGTGTAGCCCGAGTGCAGG GGG Intronic
No off target data available for this crispr