ID: 1070976586

View in Genome Browser
Species Human (GRCh38)
Location 10:80610247-80610269
Sequence CAGGGTGAGCTGAGGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070976586_1070976593 8 Left 1070976586 10:80610247-80610269 CCAGTGTCCCTCAGCTCACCCTG 0: 1
1: 0
2: 1
3: 32
4: 346
Right 1070976593 10:80610278-80610300 CTGGACAGAGTGTGCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070976586 Original CRISPR CAGGGTGAGCTGAGGGACAC TGG (reversed) Intronic
900973054 1:6002055-6002077 CAGGCTGAGCTGGGGGACAGAGG - Intronic
901055380 1:6446668-6446690 CAGGGTGCCCTGGGGAACACTGG + Intronic
902478990 1:16701921-16701943 CAGGGTGCCCTGGGGAACACTGG - Intergenic
902558308 1:17260185-17260207 CAGGGACAGGGGAGGGACACCGG + Intronic
902705400 1:18200818-18200840 CAGGGTCAGCTCAGTGACAGAGG - Intronic
903384009 1:22915089-22915111 GAGGGTGCGCTCAGAGACACGGG + Intronic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
905124146 1:35705532-35705554 CAGGGGCAGCTAAGGGATACAGG - Intergenic
905492031 1:38352095-38352117 CAGGGGCAGCTGAAGGACAGTGG - Intergenic
908755364 1:67464692-67464714 CAGGTTGAGATGAGAGCCACTGG - Intergenic
912797262 1:112700775-112700797 CAGGGTCAGCTTAGGGGCTCAGG - Intergenic
912804571 1:112744891-112744913 TGGGGTGAGTAGAGGGACACAGG - Intergenic
914247653 1:145897766-145897788 CAGGGTGACCTGAGACAGACTGG - Intronic
915479045 1:156172769-156172791 GAGGGTGAGCTGAGGGGAAGGGG + Intronic
915496284 1:156284933-156284955 GAGGGTGAGTCAAGGGACACAGG - Intronic
915677741 1:157547348-157547370 TTGGGTGAGGTGAGGGCCACTGG - Intronic
916166895 1:161972844-161972866 CAGGGTGAACTAGGGGCCACTGG + Intergenic
916562389 1:165944248-165944270 CAGGCTGCCCTGATGGACACAGG + Intergenic
917670706 1:177270787-177270809 TAGGGTGGGCTGAAGGACAGAGG - Intronic
918056020 1:181022729-181022751 CGGGGTGGGCGGAGGGAGACCGG - Exonic
918383649 1:183983724-183983746 CAGGAGGAGCTGAGGCACAGTGG + Intronic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
921582966 1:216916247-216916269 CAGGGAGAGCTGAGGGTCCCTGG - Intronic
922082217 1:222308404-222308426 CAAGGGGAGTTGAGGCACACGGG - Intergenic
922585919 1:226735578-226735600 CAGGGTGCGCTCAGGGTCACTGG + Exonic
923658124 1:235935888-235935910 CAGGATGCGCTGAGGAAGACAGG + Intergenic
1063121323 10:3106941-3106963 CAGGGTGAGGAGAGGGGCAGGGG - Intronic
1063201110 10:3785745-3785767 CAGGGTGAGCTGCCGGAACCGGG - Intergenic
1063975626 10:11413436-11413458 CAGAGGGAGTTCAGGGACACAGG - Intergenic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1069836705 10:71313748-71313770 CACGGGGAGATGAGGGACATGGG + Intergenic
1070569981 10:77633501-77633523 CAGGATGAGATGAGGCACAAGGG + Intronic
1070642636 10:78180570-78180592 CAGGGTGAGTTGCAGGACAGCGG + Intergenic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072237525 10:93466145-93466167 CTGGGGGAGCACAGGGACACAGG + Intronic
1072250163 10:93575614-93575636 CTGTGTAAGCTGAAGGACACAGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1075447934 10:122526684-122526706 CAGGGTGACTTGAGGCACTCAGG + Intergenic
1075528204 10:123203415-123203437 CAGGGGGTCCTGAGGGACAGAGG + Intergenic
1075546785 10:123361191-123361213 CAGGGTGAGCAGTGGGTCAGGGG + Intergenic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076674148 10:132139703-132139725 CAGGGTGTGGGGAGGCACACAGG + Intronic
1076686821 10:132201911-132201933 AAGGCTGAGCTGAGGGCGACGGG - Intronic
1077133234 11:985378-985400 CAGGGTGGGCTGCGGGCCACTGG + Intronic
1077221029 11:1416435-1416457 CAGGGAGAGGTGACGGGCACTGG - Intronic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1077540860 11:3145906-3145928 CTGGGTGGGCTGAGGGTTACAGG + Intronic
1081854426 11:46294981-46295003 CAGGCTGAGCTGTGGGATAAGGG - Intronic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1081887202 11:46508040-46508062 CAGGATGGGGTGAGGGACAGAGG - Intronic
1083898300 11:65631300-65631322 AGGGGTAAGCTGAGGGACACAGG - Intronic
1083923000 11:65790423-65790445 CAGGCTGGGCGGTGGGACACTGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084474934 11:69383484-69383506 AGATGTGAGCTGAGGGACACTGG - Intergenic
1084791805 11:71479771-71479793 CAGGGGGCACTGTGGGACACAGG - Intronic
1086299279 11:85407954-85407976 CAGGCTGATCTGAGGGATATGGG + Intronic
1086771086 11:90768544-90768566 CAGGTTGAGTTGAAGCACACAGG + Intergenic
1088844511 11:113653434-113653456 CAGAGTGTGCTGAGGGACTTGGG - Intergenic
1089065441 11:115659122-115659144 CAGGGGGAGGGGAAGGACACAGG + Intergenic
1089339680 11:117748983-117749005 AAGGGTGAGCTGTGGGCCATGGG - Intronic
1089536323 11:119162546-119162568 CAGGGTGAGAGGAGGTAGACAGG - Exonic
1090261319 11:125322706-125322728 CTGGGGGATCTGGGGGACACAGG - Intronic
1091286459 11:134411310-134411332 CGGGGCGCGCTGAGGGACCCAGG - Intronic
1091401870 12:186049-186071 CAGGGTGAGCCCAGGGTCAGGGG + Intergenic
1091699007 12:2647743-2647765 CAGGGCCAGCTGAAGGACAGAGG - Intronic
1091973029 12:4804133-4804155 GATGGTGAGAGGAGGGACACGGG + Intronic
1092055593 12:5505804-5505826 CTGGGTGAGCTGATTGCCACTGG + Intronic
1092173450 12:6387661-6387683 CAGGCGTAGCTGACGGACACTGG + Intronic
1092649476 12:10617998-10618020 CACGGTGAGCTAAGGGAAAGTGG - Intergenic
1093342788 12:17998706-17998728 CAGGCTGACCTCAGTGACACAGG + Intergenic
1096518906 12:52173287-52173309 AAGGGGGAGCTGAGGGAGCCTGG - Intronic
1096773685 12:53951589-53951611 GAGGACGAGCTGAGGGACACAGG + Intergenic
1097680991 12:62648577-62648599 CGGGGTGTGCTGAAGGACAGAGG - Exonic
1098167231 12:67710891-67710913 CAGGGTGTGCTGTGGGAGCCAGG + Intergenic
1100774829 12:97962625-97962647 CGTGTTGAGCTGAGGGAAACTGG - Intergenic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1102559452 12:113751884-113751906 CATGGTGGGCTCAGGGGCACTGG + Intergenic
1103023774 12:117557310-117557332 CAGAGCGGGCTGTGGGACACTGG - Intronic
1103484669 12:121274456-121274478 CAGGATGAGCTGGGGGGCAGGGG - Exonic
1104350916 12:128043178-128043200 AAGGGTGAGATGAGTGAGACTGG - Intergenic
1106121022 13:26860171-26860193 CAGGGTGTGGTGGGGGGCACCGG - Intergenic
1107426927 13:40303437-40303459 CAGAGTGAGCTGATAGGCACTGG - Intergenic
1107834892 13:44405084-44405106 CATGGTGCACTGAGGTACACAGG + Intergenic
1109126815 13:58528454-58528476 CGGGGGGAGCTGGGGGACGCGGG - Intergenic
1112001184 13:95211399-95211421 CAGTTCGAACTGAGGGACACTGG + Intronic
1113709784 13:112455587-112455609 CACGGTGAGGTGAGGCAGACAGG + Intergenic
1116003357 14:39267298-39267320 CGGGGGGAGCTGGGGGACAGGGG - Exonic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118780577 14:69005135-69005157 CAGGGTGAGCTGGTTAACACTGG + Intergenic
1119156977 14:72420507-72420529 CAGGGTTAGCTGAAGGGAACAGG - Intronic
1119544345 14:75460741-75460763 GTGGGAGAGCTGAGGGACCCTGG + Intronic
1119735404 14:76978236-76978258 GAGGGTGAGCTGAGGGGCTGAGG - Intergenic
1119767078 14:77196882-77196904 CAGGCTGGGCTGAGGGGCAAGGG - Intronic
1121824051 14:96995959-96995981 GGGGGTCAGGTGAGGGACACAGG + Intergenic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1123149881 14:106170591-106170613 CAGGGTGTGCTTAGGACCACGGG - Intergenic
1123865545 15:24516090-24516112 CAGAGTGGGCTGATGGGCACTGG - Intergenic
1124170272 15:27366821-27366843 CAAGGTGGGCAGGGGGACACGGG - Intronic
1125592717 15:40864733-40864755 CCAGGTGAGGAGAGGGACACTGG + Intergenic
1126119146 15:45235811-45235833 CAGGGTCTACTGAGGGAAACAGG + Intergenic
1126135590 15:45387507-45387529 CAAGGTGTGCTGTGGTACACAGG - Intronic
1127612762 15:60653039-60653061 AAGCGTGATCTGAGTGACACTGG + Intronic
1127700644 15:61496982-61497004 TAGGGTGAGCTCAGAGCCACAGG - Intergenic
1128315416 15:66656467-66656489 CAGGGTAAGCTGGGGCCCACTGG + Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1128709288 15:69859793-69859815 CAGTAAGAGCTGTGGGACACTGG + Intergenic
1128877290 15:71212840-71212862 CTGGGGGAGCTGAGGGGCCCTGG + Intronic
1129296272 15:74602068-74602090 GAGGGTGGGCTGTGGGGCACAGG - Intronic
1129461389 15:75701722-75701744 CATGGACATCTGAGGGACACTGG - Intronic
1130270115 15:82441784-82441806 CAGGGTCCTCTGAGGGACCCTGG + Intergenic
1130485528 15:84396288-84396310 CAGGGTCCTCTGAGGGACCCTGG + Intergenic
1130490221 15:84425688-84425710 CAGGGTCCTCTGAGGGACCCTGG - Intergenic
1130847905 15:87764654-87764676 CAGGCTGCGCTAAGGGAGACTGG - Intergenic
1131462591 15:92629090-92629112 AAGGCTGTGCTGAGGAACACAGG + Intronic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132813851 16:1816746-1816768 CAGGGCGAGCTGGGCCACACTGG + Intronic
1133280002 16:4659881-4659903 CAGGGCCAGCTGAGGGAGATGGG - Intronic
1133868245 16:9664006-9664028 CGTGGTGAGCTGAGTGACAAAGG - Intergenic
1134567791 16:15266144-15266166 CAGGGTGGGCTGGGGGATATGGG - Intergenic
1134734644 16:16490209-16490231 CAGGGTGGGCTGGGGGATATGGG + Intergenic
1134932828 16:18221697-18221719 CAGGGTGGGCTGGGGGATATGGG - Intergenic
1135425061 16:22328327-22328349 CATGGTGAGGTGAGAGGCACAGG + Intronic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136419762 16:30124282-30124304 CGGGGTGAGCTGAGGCATAAAGG + Intergenic
1138009147 16:53361824-53361846 GTGGGTGAGTTGGGGGACACGGG - Intergenic
1139936943 16:70578356-70578378 CAGGTTTTCCTGAGGGACACAGG - Intergenic
1142011253 16:87715452-87715474 CAGGATGAGCTGCGGAGCACTGG - Intronic
1142294237 16:89209869-89209891 CAGGGAGACCTGGGGGAGACCGG + Intergenic
1142742772 17:1940708-1940730 GAGTGTGAGCTGAGAGAGACGGG - Intronic
1143777995 17:9212165-9212187 CAGGGAGAGCTGGGGCCCACAGG - Intronic
1144101626 17:11946801-11946823 CAGGTTGAGCATAGGGAGACAGG + Intronic
1144584198 17:16478032-16478054 CAGGGTGAGAGCAGGGACGCTGG - Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1148137810 17:45306514-45306536 CTGGGTGGGCTGAGGAACACAGG - Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1149040952 17:52187565-52187587 CAGTGTGAGCTCAGGGACATGGG + Intergenic
1149568090 17:57653466-57653488 CTGGGGGGACTGAGGGACACTGG - Intronic
1149649161 17:58265970-58265992 AAGGGTGTGCTCAGGGAGACAGG - Intronic
1150226788 17:63528748-63528770 CAGTTTGAGTTGAGGGACATAGG + Intronic
1151493599 17:74446656-74446678 CAGGGTGAGATAAGGGGCTCAGG + Intronic
1151678389 17:75611529-75611551 GAGGGTGTGGGGAGGGACACTGG + Intergenic
1151843464 17:76634370-76634392 CAGGGAGTGGAGAGGGACACAGG - Intronic
1151974307 17:77475781-77475803 CAGGGTGTGGTGAGTGCCACCGG + Intronic
1151988095 17:77556884-77556906 CACGGTTAGCTGAAGGACATTGG - Intergenic
1152418000 17:80175560-80175582 CAGGGTCAGCTGAGGTGAACAGG + Intronic
1152580302 17:81162802-81162824 GGGCGTGAGCTGAGGGACAGGGG + Intronic
1152614678 17:81332316-81332338 AATGCTGAGCCGAGGGACACTGG + Intergenic
1154437532 18:14358131-14358153 CAGGCTGTGCTAAGGGACAGTGG - Intergenic
1155565883 18:27133551-27133573 CAGGGGCAGCTGTGGGACACTGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1158615590 18:58983614-58983636 CAGGGTGGGATGAGGGCCATGGG - Intronic
1160425183 18:78774233-78774255 CAGGGTGTGCTTAGGGAGTCAGG + Intergenic
1160501265 18:79402028-79402050 CAGGGTGGGCTGTGCCACACTGG + Intronic
1160538012 18:79605626-79605648 CAGGGTGGGCTCCGGGCCACGGG - Intergenic
1160567081 18:79792855-79792877 TCGGGAGGGCTGAGGGACACAGG + Intergenic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160881263 19:1321820-1321842 CAGGGCCAGCTGGGAGACACAGG - Intergenic
1160949098 19:1657246-1657268 CAGGGGAAGCTGAGGGACAAAGG + Intergenic
1161175800 19:2841645-2841667 TGGGGGGAGCTGAGGGACGCGGG + Intronic
1161945736 19:7435423-7435445 CAGGGTCAGTTGAGGGACAGAGG + Intronic
1162321513 19:9973604-9973626 CAGGGTGAGCGAGGGGACGCTGG - Exonic
1162384079 19:10350824-10350846 CAGCGTGTGCTGAGGCACAATGG - Exonic
1162477334 19:10908380-10908402 CAGGTGGAGCTCAGGGCCACAGG + Intronic
1162490422 19:10987958-10987980 CAGGGGGACATGGGGGACACAGG - Intronic
1162752513 19:12837622-12837644 CAGGGTGATGTGATGGACAATGG - Intronic
1163460050 19:17431802-17431824 CAGGGGCAGCTGAGAGACACGGG - Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164573503 19:29391176-29391198 CAGGGTGTGCTCAGGGACTGTGG + Intergenic
1164698640 19:30265752-30265774 CAGGCTGGCCTTAGGGACACGGG + Intronic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165264325 19:34647403-34647425 CAGTGTGGGCTGATGGGCACAGG - Intronic
1165734902 19:38169915-38169937 CAGGGTAAGATGAGGGGCCCAGG + Intronic
1165734914 19:38169947-38169969 CAGGGTGAGATGAGGGGCCCAGG + Intronic
1165734926 19:38169979-38170001 CAGGGTAAGATGAGGGGCCCAGG + Intronic
1166231546 19:41427857-41427879 CAGGGTGAGGTGGGGGGAACGGG + Intronic
1166326519 19:42054225-42054247 CAGGGAGGGCAGAGGGCCACAGG + Intronic
1166369428 19:42292883-42292905 CAGAGTGAGTTGGGGGACCCAGG + Intronic
1166673937 19:44727813-44727835 CAGGATGAGCTGGGGGAGAGTGG - Intergenic
1166777808 19:45323244-45323266 CAGGGGGAGCCGAGGGCCACAGG - Intergenic
1167465836 19:49650898-49650920 CAAGGTGAGGTGACGGGCACAGG - Exonic
1168347749 19:55659181-55659203 AAGGGTGAGAGGAGGGGCACGGG - Intronic
1202713031 1_KI270714v1_random:27828-27850 CAGGGTGCCCTGGGGAACACTGG - Intergenic
926904235 2:17791112-17791134 GAGGATGAGGTGAGGGAGACAGG - Intronic
927211363 2:20640934-20640956 CGGGGAGACCTGAGGGACATGGG + Intronic
929434041 2:41913734-41913756 GAGGGTGCTCTGAGGAACACTGG + Intergenic
930584944 2:53257480-53257502 CAGCGTGAGCTGACTGAAACAGG + Intergenic
932454024 2:71834709-71834731 GAGGGTGAACTGAGGGGCAAAGG + Intergenic
933263485 2:80155628-80155650 CAGGGAGAGCTGAGGCAGATTGG + Intronic
934300888 2:91775518-91775540 TAGGCTGAGGTGGGGGACACAGG + Intergenic
934750870 2:96793349-96793371 CAGGGTGAGCTTTGGGCCCCTGG - Intronic
937306790 2:120876638-120876660 CAGGGTTGGAGGAGGGACACAGG + Intronic
938236742 2:129711663-129711685 CAGGCTGATCTGGGGTACACGGG - Intergenic
938716679 2:134027906-134027928 GAGGCTGAGCTGAGGGGGACCGG + Intergenic
940815207 2:158290131-158290153 CAGGTTGAGGTGAGGCACACAGG + Intronic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
945180609 2:207087439-207087461 GAGGGGGAGGTGTGGGACACAGG + Intronic
947718228 2:232352377-232352399 CAGAGGGCGCTGAGAGACACAGG - Intergenic
947973370 2:234343421-234343443 CAAGGTCTCCTGAGGGACACAGG - Intergenic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
1168870167 20:1120721-1120743 CAGGGGGAGCTGAGGGCCAATGG - Intronic
1169117408 20:3074648-3074670 CAGGGTGAATTGAGGCTCACAGG + Intergenic
1169143985 20:3240637-3240659 GAGGAAGAGCTGAAGGACACAGG + Intergenic
1169195319 20:3679597-3679619 GAGGGGGACCTGAGGAACACAGG + Intronic
1170943037 20:20864969-20864991 CAGGCTGAGCTAAGGAACATTGG - Intergenic
1171489773 20:25508658-25508680 CAGGGGGAGCTGGGGGGCGCTGG + Intronic
1172015749 20:31871353-31871375 TAGGGTTAGCTGGGGGTCACGGG - Intronic
1172293317 20:33791269-33791291 CTGGAGGAGCTGAAGGACACAGG + Exonic
1172765111 20:37346688-37346710 CAGGGCGGGCTGAGGGGCCCCGG + Intronic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1173124320 20:40322582-40322604 CAGGCTGAGATGAGAGAAACTGG + Intergenic
1173836071 20:46126752-46126774 AAGGGGGAGATGAGGCACACAGG + Intronic
1174461844 20:50688865-50688887 CAGGATGAACTGGGGGACCCTGG + Intronic
1174568507 20:51484341-51484363 CAGGGTGTGTGGAGGGACAGTGG - Intronic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1177391560 21:20480496-20480518 CAGTGTGAGCTGAGAGTGACTGG - Intergenic
1177612727 21:23473681-23473703 CAGGGTGAGCTGACTGAAAAGGG - Intergenic
1179310285 21:40189500-40189522 CTGGGTGTGCTAAGGGACATAGG - Intronic
1180748311 22:18107474-18107496 CAGGGTGAGATGGGGGATCCAGG + Intronic
1181319716 22:21995066-21995088 GAGGGTGAGCTGAGGTCCAGGGG - Intergenic
1182776738 22:32837046-32837068 CTAGGAGAGCTGAGGGACTCTGG - Intronic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1184511568 22:44936387-44936409 CAGGGAGAGATGAGGGCCACAGG - Intronic
1184693363 22:46127401-46127423 CAGGGTGAGGTCAGGGGCAGGGG - Intergenic
1184723668 22:46330566-46330588 GAGGGTGGGCTGAGGGACTGGGG + Exonic
1184889234 22:47369321-47369343 GAGGGAGAGATGAGAGACACGGG + Intergenic
1185047797 22:48537682-48537704 CAGGGAGAGCTGCAGGACCCTGG - Intronic
1185376635 22:50485641-50485663 CAGGGAGTGCTGAGTGCCACAGG + Exonic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
950359589 3:12441014-12441036 CAAGGGGAGGGGAGGGACACCGG + Intergenic
950514204 3:13453538-13453560 GAGAGTGAGCTCAGGGCCACTGG + Intergenic
952262755 3:31756325-31756347 ATGGGTGGGCTGAGGGACAGTGG - Intronic
952729968 3:36628423-36628445 CAGAGTTACCTGGGGGACACTGG + Intergenic
953547637 3:43875386-43875408 TAGGGTGGGCTGAGGGGCCCTGG - Intergenic
953574892 3:44105098-44105120 CAGCCTGAGCTGGGAGACACTGG - Intergenic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
954642796 3:52111832-52111854 CAGGGTGAGAAGTGGGAGACAGG + Intronic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
956316873 3:67947957-67947979 GAGGGTGAGCTGAAGGAGAGCGG + Intergenic
957484819 3:80845941-80845963 AAGGATGAACTTAGGGACACTGG - Intergenic
960823520 3:121758766-121758788 CAAGATGAGTTCAGGGACACAGG - Intergenic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961474277 3:127136968-127136990 GAGGATGAGCTGGGGGACAGAGG - Intergenic
961552886 3:127679171-127679193 CTGGTTGAGCTGTGTGACACTGG + Intronic
961553981 3:127685170-127685192 CAGGCTGTGCTGGCGGACACTGG + Intergenic
961645858 3:128392468-128392490 ACGGGTGAGCTGAGGTACCCTGG - Intronic
963138387 3:141928532-141928554 CAGGTTGAGCTGAGGGAGTGTGG + Intergenic
963312908 3:143728390-143728412 CAGGGAGAGTGGATGGACACAGG + Intronic
963319132 3:143793876-143793898 GTGGGTGACCTGAGAGACACAGG - Intronic
964515012 3:157498328-157498350 CAGGGTGTTTTGAGGGTCACAGG + Intronic
966199610 3:177348286-177348308 CAGGGTGGGCTGGGGGAAAGAGG + Intergenic
967360224 3:188622198-188622220 CAGGTTAAGATGAGTGACACTGG - Intronic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
968698832 4:2045288-2045310 CAGGCTTGGCTGTGGGACACTGG + Intergenic
968745631 4:2358535-2358557 CAGGGAGCCCTGAGGCACACAGG - Intronic
970044264 4:11832307-11832329 CAGGGTGATCTGAGAGTAACTGG + Intergenic
973810784 4:54568086-54568108 GAGGTTGGGCTAAGGGACACTGG - Intergenic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
979505155 4:121486477-121486499 CAGGGAGAGCTGAGTGACCTAGG - Intergenic
981871160 4:149487465-149487487 CAGGCTGAGCTTAGAGACAGTGG - Intergenic
985681115 5:1256467-1256489 CTGGGTGAGATGAGGTACACGGG - Intronic
985681135 5:1256535-1256557 GTGGGTGAGATGAGGTACACGGG - Intronic
985720170 5:1484800-1484822 CAGGGGAAGCTGCGGCACACGGG - Intronic
986200053 5:5571627-5571649 CCAGGAGTGCTGAGGGACACAGG - Intergenic
986835270 5:11630313-11630335 CAGGGTGGACTGCAGGACACTGG + Intronic
988555013 5:32229049-32229071 CAGGGAGTGCAGAGGGACAGCGG + Exonic
992616118 5:78547846-78547868 CAGGGTGGTCTGAGGGAGACTGG + Intronic
996357519 5:122613074-122613096 GAGGGGGAGCTGAGGGCTACAGG - Intergenic
996856563 5:128014803-128014825 CAGGGTGAGCTTATGAACACAGG + Intergenic
998703357 5:144731207-144731229 CAGGGTGAGCGCAGCTACACAGG - Intergenic
999648259 5:153740305-153740327 CAGAGTGAGATAAGGGAGACAGG + Intronic
1000538275 5:162506322-162506344 CAGGGTGAACTGAAAGCCACAGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002889763 6:1322394-1322416 CTGGGTGACCTTAGGGAAACGGG + Intergenic
1002894886 6:1372149-1372171 CAGGGTGAGCTTAGGGGCCCTGG + Intergenic
1002972807 6:2041629-2041651 CAGGCTGAGGTGAGGGTCAAGGG + Intronic
1003047185 6:2744632-2744654 CAGGATGTGCAGAGGGACAGTGG - Intronic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1004529066 6:16436775-16436797 CTGAGTGAGCTGAGAGGCACTGG + Intronic
1004983082 6:21048028-21048050 CAGGGTGAGTTGAGGGCCAGTGG - Intronic
1005670838 6:28104884-28104906 CTGGCTGAGCTGGGGGACTCGGG - Intergenic
1005784820 6:29232965-29232987 CTTGGAGAGCTGTGGGACACTGG - Intergenic
1005806666 6:29479680-29479702 CAGGAAGACCTAAGGGACACAGG - Intergenic
1005999811 6:30955977-30955999 CAGGGTGATCGGAGGATCACAGG - Intergenic
1006012874 6:31056978-31057000 CATGGAGAGCTGAGGTACAGAGG + Intergenic
1006296235 6:33171305-33171327 CAGGGTGAGGTGGGGGACCCCGG - Exonic
1007380603 6:41488104-41488126 CTGGGAGCGCTGAGGGACTCTGG - Intergenic
1007602753 6:43093376-43093398 AAGGCTGAGCTGGGGGACACTGG + Intronic
1007653341 6:43436780-43436802 CGGGTTGAGCTGTGGGGCACAGG - Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1007765600 6:44158046-44158068 CAGGCAGGGCTGAGGGGCACTGG + Intergenic
1007929150 6:45675330-45675352 CAGGGTGAGCTGTAGAAGACGGG - Intergenic
1011220872 6:85053186-85053208 GAGGGTGAGCTGAGGGGAAGGGG + Intergenic
1011760194 6:90555741-90555763 CATGGTGACCAGAGGCACACAGG - Intronic
1012977674 6:105797388-105797410 CAGGTTTGCCTGAGGGACACAGG + Intergenic
1013156000 6:107491133-107491155 GAGGGTGAGCTGGGGGAGAGGGG - Intronic
1015545955 6:134361514-134361536 CAGGGTAAGGTGATGGAGACAGG - Intergenic
1016887509 6:148971677-148971699 CAGGGCGAGCTGAGGAAGAAAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018684899 6:166296763-166296785 CAGGGTCAGCTGACGCCCACTGG - Intergenic
1018708255 6:166478459-166478481 CCGGGTGAGCTTCGGGACTCTGG + Intronic
1019333367 7:471236-471258 GAGGGTGTGTTGAGGGGCACAGG - Intergenic
1019713582 7:2528481-2528503 CAGGGTCAGGAGAGGCACACAGG + Intronic
1019913675 7:4116897-4116919 GAAGGAGAGCCGAGGGACACTGG - Intronic
1022243408 7:28534333-28534355 CAGGGTGGGCTGAGACACAGAGG - Intronic
1022539904 7:31125802-31125824 CAGGCTGAGCCAAGGCACACTGG - Intergenic
1024063703 7:45716525-45716547 CACGGTGAGCTGGGGGAGCCAGG - Exonic
1024778410 7:52816402-52816424 CAGGGTGTGCTGTGGGACTGAGG - Intergenic
1026463654 7:70635506-70635528 CAGGGAGAGCTTAGGAACCCAGG - Intronic
1026586761 7:71661782-71661804 CAGGGAGAGCTGAGGGACTTTGG + Intronic
1028241299 7:88424350-88424372 GAGGTTCAGCTAAGGGACACGGG - Intergenic
1029161517 7:98555747-98555769 CAGGGTGATATGAGGGGCCCTGG - Intergenic
1029473445 7:100768718-100768740 CTGGGTGAGCTGGGGGTCAGGGG + Exonic
1032421382 7:131782644-131782666 CAGGGTGGGGTGAGGGGCAGGGG - Intergenic
1032855529 7:135830460-135830482 CGGGCTGGGCTGGGGGACACAGG - Intergenic
1033542783 7:142372569-142372591 CATGGTGAAGTGGGGGACACAGG - Intergenic
1034283626 7:149870371-149870393 CAGTGTGGGTTGAGGGGCACTGG - Intergenic
1034378102 7:150664499-150664521 CAGGTTGTGCTGAGAGACATGGG - Intergenic
1035280454 7:157775331-157775353 CAGGGTGAGGTGAGGTAGCCTGG - Intronic
1035475571 7:159141825-159141847 CAGAGAAAGCTGAGGGACAAAGG + Intronic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1037774590 8:21825027-21825049 CAGGGTGAGCTGAGGCTCGGAGG - Intergenic
1039948711 8:42152005-42152027 CTGGGTGGGCTTAGGGACGCTGG - Intergenic
1039960427 8:42242790-42242812 TACAGGGAGCTGAGGGACACTGG + Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040015010 8:42692678-42692700 CAGGGTGAGTTGTGGGGCTCGGG - Intergenic
1040299564 8:46180861-46180883 CTGGGTGAGCCGAGGGACTCAGG - Intergenic
1040560418 8:48518648-48518670 GAGGGTGTGCTGAGGGAAAGTGG + Intergenic
1041219311 8:55633198-55633220 GAGGGTGTCATGAGGGACACAGG + Intergenic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1042840458 8:73118251-73118273 AGGGGTGGGCTGAGGGACACAGG + Intronic
1044728255 8:95210051-95210073 CTGGGTCTTCTGAGGGACACAGG + Intergenic
1045801727 8:106109966-106109988 CAGGGTGGGCAGAGTGGCACTGG - Intergenic
1048331011 8:133470843-133470865 CAGGGTGAGGTGAGGCACCCAGG - Intronic
1048969775 8:139638999-139639021 GAGGGTGGGATGAGGGACATGGG - Intronic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1050083295 9:1938270-1938292 CACAGAGTGCTGAGGGACACAGG + Intergenic
1050246813 9:3698691-3698713 GAGGGTGAGCTCAGGGTCAGTGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1050937947 9:11422946-11422968 CAGGATGAGCTTAGGAAGACAGG - Intergenic
1053415039 9:37942121-37942143 CAAGAAGAGCTGAGGGGCACTGG - Intronic
1055201532 9:73668290-73668312 TGGGCTGAGTTGAGGGACACAGG + Intergenic
1058566312 9:106288972-106288994 CAAGATGATCTGAGGGACAATGG - Intergenic
1061857413 9:133449807-133449829 CAGCGTGAGCTGTGGGAGAGGGG + Exonic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1062053598 9:134459422-134459444 CAGGGTGAGGTCAGGGAGAATGG + Intergenic
1062059773 9:134488917-134488939 CAGTGTGAGATGAGGGGCAGAGG + Intergenic
1062294679 9:135818147-135818169 CAGGGCGAGGTGAGGGGAACAGG - Intronic
1062355425 9:136159852-136159874 CAGGTTCCGCTGAGGGACCCTGG - Intergenic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062614595 9:137390700-137390722 GAGGGTGACATGAGGGAGACCGG - Intronic
1062672594 9:137720215-137720237 CAGGGTGACGTCAGGGACCCTGG - Intronic
1185705415 X:2262980-2263002 GAGGGTGAGCCCAGGGGCACAGG - Intronic
1186490331 X:9967296-9967318 CATGGTGAGCGGGGGGACCCTGG - Intergenic
1187130191 X:16495014-16495036 CAAGGTCATCTGAGGGTCACTGG + Intergenic
1190286341 X:48963876-48963898 GAGAGTGAGCTGGGGGAGACTGG - Intronic
1192051255 X:67725829-67725851 CAGGGTGTGCCCTGGGACACTGG + Exonic
1195381686 X:104277127-104277149 GAGGGTGAGGTGAGGGAGATGGG - Intergenic
1196594047 X:117522532-117522554 CCAGGTGAGCTGGGGGAGACAGG - Intergenic
1196783731 X:119404464-119404486 CAGGGTGAGGTAAGGGGCAGGGG + Intronic
1196802046 X:119552501-119552523 CAGGGTGAGCTAAGGGGCAAGGG + Intronic
1197138784 X:123093436-123093458 CAGGATGGGGTGAGGGACAGGGG - Intergenic
1197550076 X:127881003-127881025 CAGGCAGAGCTTAGGGACATAGG - Intergenic
1199061356 X:143358866-143358888 TAGGGTGAGAGGTGGGACACGGG + Intergenic
1199972156 X:152869104-152869126 GAGGGTCAAGTGAGGGACACTGG + Exonic
1200069260 X:153519717-153519739 CAGGTGGAGCTGATGGAGACTGG - Intronic
1201298793 Y:12488523-12488545 CAGCGTGAGGTGAGGAACAAAGG - Intergenic
1202062263 Y:20899895-20899917 CAAGGTAAGCTGAGGGACTGAGG - Intergenic
1202372682 Y:24209305-24209327 CAGGGTCTTCTGAGGGACCCAGG - Intergenic
1202376840 Y:24246025-24246047 CAGGGTCCTCTGAGGGACCCTGG - Intergenic
1202493940 Y:25424096-25424118 CAGGGTCCTCTGAGGGACCCTGG + Intergenic
1202498100 Y:25460815-25460837 CAGGGTCTTCTGAGGGACCCAGG + Intergenic