ID: 1070982362

View in Genome Browser
Species Human (GRCh38)
Location 10:80659908-80659930
Sequence AACTGTCTAGGTGGGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070982362_1070982370 6 Left 1070982362 10:80659908-80659930 CCATATGCCCCACCTAGACAGTT No data
Right 1070982370 10:80659937-80659959 ACTTTTGGGACACTTTCTGGTGG No data
1070982362_1070982367 -9 Left 1070982362 10:80659908-80659930 CCATATGCCCCACCTAGACAGTT No data
Right 1070982367 10:80659922-80659944 TAGACAGTTTTATTCACTTTTGG No data
1070982362_1070982368 -8 Left 1070982362 10:80659908-80659930 CCATATGCCCCACCTAGACAGTT No data
Right 1070982368 10:80659923-80659945 AGACAGTTTTATTCACTTTTGGG No data
1070982362_1070982369 3 Left 1070982362 10:80659908-80659930 CCATATGCCCCACCTAGACAGTT No data
Right 1070982369 10:80659934-80659956 TTCACTTTTGGGACACTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070982362 Original CRISPR AACTGTCTAGGTGGGGCATA TGG (reversed) Intergenic
No off target data available for this crispr