ID: 1070985915

View in Genome Browser
Species Human (GRCh38)
Location 10:80689755-80689777
Sequence ATGTTTATGAATGGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070985912_1070985915 2 Left 1070985912 10:80689730-80689752 CCTTCTTAGTTATCAGGATAGAA No data
Right 1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG No data
1070985910_1070985915 10 Left 1070985910 10:80689722-80689744 CCACAAAGCCTTCTTAGTTATCA No data
Right 1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG No data
1070985909_1070985915 20 Left 1070985909 10:80689712-80689734 CCTCTAAGAGCCACAAAGCCTTC No data
Right 1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070985915 Original CRISPR ATGTTTATGAATGGGCAAGA AGG Intergenic
No off target data available for this crispr