ID: 1070996564

View in Genome Browser
Species Human (GRCh38)
Location 10:80788729-80788751
Sequence AGTTTCTTCTAGAAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070996561_1070996564 -7 Left 1070996561 10:80788713-80788735 CCCAAAATGTTTTAATAGTTTCT No data
Right 1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG No data
1070996560_1070996564 1 Left 1070996560 10:80788705-80788727 CCACAAATCCCAAAATGTTTTAA No data
Right 1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG No data
1070996562_1070996564 -8 Left 1070996562 10:80788714-80788736 CCAAAATGTTTTAATAGTTTCTT No data
Right 1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070996564 Original CRISPR AGTTTCTTCTAGAAGAATGA GGG Intergenic
No off target data available for this crispr