ID: 1070999126

View in Genome Browser
Species Human (GRCh38)
Location 10:80814234-80814256
Sequence GGCCAACGGGAGTTCCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070999107_1070999126 26 Left 1070999107 10:80814185-80814207 CCCTCAGCTTGCTGGGAGGTGTG 0: 17
1: 1057
2: 686
3: 468
4: 393
Right 1070999126 10:80814234-80814256 GGCCAACGGGAGTTCCGGGTGGG No data
1070999108_1070999126 25 Left 1070999108 10:80814186-80814208 CCTCAGCTTGCTGGGAGGTGTGG 0: 17
1: 1036
2: 666
3: 464
4: 534
Right 1070999126 10:80814234-80814256 GGCCAACGGGAGTTCCGGGTGGG No data
1070999119_1070999126 -9 Left 1070999119 10:80814220-80814242 CCGGTGGGAACCGGGGCCAACGG No data
Right 1070999126 10:80814234-80814256 GGCCAACGGGAGTTCCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070999126 Original CRISPR GGCCAACGGGAGTTCCGGGT GGG Intergenic
No off target data available for this crispr