ID: 1071005466

View in Genome Browser
Species Human (GRCh38)
Location 10:80879381-80879403
Sequence TTCAACAAACAGTCTGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071005464_1071005466 2 Left 1071005464 10:80879356-80879378 CCAACAACCTCTTCTAAGTTAAA No data
Right 1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG No data
1071005463_1071005466 7 Left 1071005463 10:80879351-80879373 CCTCACCAACAACCTCTTCTAAG No data
Right 1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG No data
1071005465_1071005466 -5 Left 1071005465 10:80879363-80879385 CCTCTTCTAAGTTAAAAATTCAA No data
Right 1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG No data
1071005461_1071005466 24 Left 1071005461 10:80879334-80879356 CCTCATTTCTTCTGAGCCCTCAC No data
Right 1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG No data
1071005462_1071005466 8 Left 1071005462 10:80879350-80879372 CCCTCACCAACAACCTCTTCTAA No data
Right 1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071005466 Original CRISPR TTCAACAAACAGTCTGATTA AGG Intergenic
No off target data available for this crispr