ID: 1071008737

View in Genome Browser
Species Human (GRCh38)
Location 10:80913013-80913035
Sequence GAAGTGAGCTTGTCTAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071008728_1071008737 26 Left 1071008728 10:80912964-80912986 CCTCGTGTTTCTGAAGGACCTGT No data
Right 1071008737 10:80913013-80913035 GAAGTGAGCTTGTCTAAATAGGG No data
1071008733_1071008737 8 Left 1071008733 10:80912982-80913004 CCTGTGGAATGGATGTATTGGGA No data
Right 1071008737 10:80913013-80913035 GAAGTGAGCTTGTCTAAATAGGG No data
1071008727_1071008737 27 Left 1071008727 10:80912963-80912985 CCCTCGTGTTTCTGAAGGACCTG No data
Right 1071008737 10:80913013-80913035 GAAGTGAGCTTGTCTAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071008737 Original CRISPR GAAGTGAGCTTGTCTAAATA GGG Intergenic
No off target data available for this crispr