ID: 1071020568

View in Genome Browser
Species Human (GRCh38)
Location 10:81050084-81050106
Sequence ATTTAGAAGATGAATGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071020568_1071020570 30 Left 1071020568 10:81050084-81050106 CCCTTTTCATTCATCTTCTAAAT No data
Right 1071020570 10:81050137-81050159 TTTATGCTTACACATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071020568 Original CRISPR ATTTAGAAGATGAATGAAAA GGG (reversed) Intergenic
No off target data available for this crispr