ID: 1071020676

View in Genome Browser
Species Human (GRCh38)
Location 10:81051241-81051263
Sequence TAGTGCCAAGGCAATTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071020674_1071020676 9 Left 1071020674 10:81051209-81051231 CCTTATATTTATGGTCTTTTGAT No data
Right 1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071020676 Original CRISPR TAGTGCCAAGGCAATTTAGT AGG Intergenic
No off target data available for this crispr