ID: 1071021402

View in Genome Browser
Species Human (GRCh38)
Location 10:81061208-81061230
Sequence TGGTCCTTCTTGGGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071021396_1071021402 -10 Left 1071021396 10:81061195-81061217 CCGGAGGCAGACATGGTCCTTCT No data
Right 1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG No data
1071021391_1071021402 21 Left 1071021391 10:81061164-81061186 CCTAAGAGGAGAGGTTTCTCCAG No data
Right 1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG No data
1071021394_1071021402 2 Left 1071021394 10:81061183-81061205 CCAGTGATGCTGCCGGAGGCAGA No data
Right 1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071021402 Original CRISPR TGGTCCTTCTTGGGGAGGGA AGG Intergenic
No off target data available for this crispr