ID: 1071025680

View in Genome Browser
Species Human (GRCh38)
Location 10:81110136-81110158
Sequence ATGTGGGAATCTAATAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071025680_1071025689 18 Left 1071025680 10:81110136-81110158 CCCAATTTATTAGATTCCCACAT No data
Right 1071025689 10:81110177-81110199 CCAAACTGAAACTTTGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071025680 Original CRISPR ATGTGGGAATCTAATAAATT GGG (reversed) Intergenic
No off target data available for this crispr