ID: 1071027481

View in Genome Browser
Species Human (GRCh38)
Location 10:81132619-81132641
Sequence CTCCCCAAGGGTCAAATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071027473_1071027481 11 Left 1071027473 10:81132585-81132607 CCAAGTTGTTTTTGTTTGGCTAT No data
Right 1071027481 10:81132619-81132641 CTCCCCAAGGGTCAAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071027481 Original CRISPR CTCCCCAAGGGTCAAATGGG GGG Intergenic
No off target data available for this crispr