ID: 1071035779

View in Genome Browser
Species Human (GRCh38)
Location 10:81243254-81243276
Sequence ACAATAACTTCAAGTGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071035778_1071035779 3 Left 1071035778 10:81243228-81243250 CCAATATGATAGATATTAATTTA No data
Right 1071035779 10:81243254-81243276 ACAATAACTTCAAGTGTCAATGG No data
1071035777_1071035779 29 Left 1071035777 10:81243202-81243224 CCAAACAACAAATAGAAATACAG No data
Right 1071035779 10:81243254-81243276 ACAATAACTTCAAGTGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071035779 Original CRISPR ACAATAACTTCAAGTGTCAA TGG Intergenic
No off target data available for this crispr