ID: 1071038763

View in Genome Browser
Species Human (GRCh38)
Location 10:81280949-81280971
Sequence CAGGGGAGACAGTAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071038752_1071038763 17 Left 1071038752 10:81280909-81280931 CCACAGGGGCCAAGGATTCAAGG No data
Right 1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG No data
1071038754_1071038763 8 Left 1071038754 10:81280918-81280940 CCAAGGATTCAAGGAAACGTATT No data
Right 1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071038763 Original CRISPR CAGGGGAGACAGTAGGGGGA TGG Intergenic
No off target data available for this crispr