ID: 1071039870

View in Genome Browser
Species Human (GRCh38)
Location 10:81294227-81294249
Sequence ATCAATAAGCTGTAAATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071039869_1071039870 8 Left 1071039869 10:81294196-81294218 CCATTTTGTGTACTTGGCATTTT No data
Right 1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG No data
1071039867_1071039870 10 Left 1071039867 10:81294194-81294216 CCCCATTTTGTGTACTTGGCATT No data
Right 1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG No data
1071039868_1071039870 9 Left 1071039868 10:81294195-81294217 CCCATTTTGTGTACTTGGCATTT No data
Right 1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071039870 Original CRISPR ATCAATAAGCTGTAAATGAG TGG Intergenic
No off target data available for this crispr