ID: 1071040416

View in Genome Browser
Species Human (GRCh38)
Location 10:81302172-81302194
Sequence GTTTTCAAGGGGAATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071040416_1071040422 24 Left 1071040416 10:81302172-81302194 CCAGCAACATTCCCCTTGAAAAC No data
Right 1071040422 10:81302219-81302241 CTCACTACTCCTTATCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071040416 Original CRISPR GTTTTCAAGGGGAATGTTGC TGG (reversed) Intergenic
No off target data available for this crispr