ID: 1071040870

View in Genome Browser
Species Human (GRCh38)
Location 10:81308047-81308069
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071040870_1071040878 4 Left 1071040870 10:81308047-81308069 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1071040878 10:81308074-81308096 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1071040870_1071040876 3 Left 1071040870 10:81308047-81308069 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1071040876 10:81308073-81308095 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1071040870_1071040880 12 Left 1071040870 10:81308047-81308069 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1071040880 10:81308082-81308104 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071040870 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr