ID: 1071049444

View in Genome Browser
Species Human (GRCh38)
Location 10:81428639-81428661
Sequence TATCCCCAGCTGCCACATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071049444_1071049447 10 Left 1071049444 10:81428639-81428661 CCAGTATGTGGCAGCTGGGGATA No data
Right 1071049447 10:81428672-81428694 CTGAAGATAAACATGAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071049444 Original CRISPR TATCCCCAGCTGCCACATAC TGG (reversed) Intergenic
No off target data available for this crispr