ID: 1071054169

View in Genome Browser
Species Human (GRCh38)
Location 10:81490122-81490144
Sequence TGGCTCTAATTGTTCTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071054169_1071054173 28 Left 1071054169 10:81490122-81490144 CCAGTGTAGAACAATTAGAGCCA No data
Right 1071054173 10:81490173-81490195 CACTAAGCGCCATTCCTAGAAGG No data
1071054169_1071054174 29 Left 1071054169 10:81490122-81490144 CCAGTGTAGAACAATTAGAGCCA No data
Right 1071054174 10:81490174-81490196 ACTAAGCGCCATTCCTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071054169 Original CRISPR TGGCTCTAATTGTTCTACAC TGG (reversed) Intergenic
No off target data available for this crispr