ID: 1071055677

View in Genome Browser
Species Human (GRCh38)
Location 10:81505871-81505893
Sequence TGCTCACCCGGAACTCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055677_1071055687 15 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055687 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
1071055677_1071055690 30 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055690 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG No data
1071055677_1071055682 -10 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055682 10:81505884-81505906 CGGGTGAGCATGGGCTCAGCGGG No data
1071055677_1071055683 7 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055683 10:81505901-81505923 AGCGGGCCCCGTGCTCAGAGCGG No data
1071055677_1071055688 29 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055677 Original CRISPR TGCTCACCCGGAACTCGCGC TGG (reversed) Intergenic
No off target data available for this crispr