ID: 1071055680

View in Genome Browser
Species Human (GRCh38)
Location 10:81505883-81505905
Sequence CCGCTGAGCCCATGCTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055680_1071055683 -5 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055683 10:81505901-81505923 AGCGGGCCCCGTGCTCAGAGCGG No data
1071055680_1071055688 17 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055680_1071055690 18 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055690 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG No data
1071055680_1071055687 3 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055687 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
1071055680_1071055695 27 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055695 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
1071055680_1071055693 26 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055693 10:81505932-81505954 CCCGCAAGCCCTGGGCAGTGAGG No data
1071055680_1071055696 28 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055696 10:81505934-81505956 CGCAAGCCCTGGGCAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055680 Original CRISPR CCGCTGAGCCCATGCTCACC CGG (reversed) Intergenic