ID: 1071055686

View in Genome Browser
Species Human (GRCh38)
Location 10:81505909-81505931
Sequence CCGGCTGGCCGCTCTGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055686_1071055695 1 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055695 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
1071055686_1071055693 0 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055693 10:81505932-81505954 CCCGCAAGCCCTGGGCAGTGAGG No data
1071055686_1071055696 2 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055696 10:81505934-81505956 CGCAAGCCCTGGGCAGTGAGGGG No data
1071055686_1071055688 -9 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055686_1071055690 -8 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055690 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG No data
1071055686_1071055700 15 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055686_1071055699 14 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055686 Original CRISPR CCGGCTGGCCGCTCTGAGCA CGG (reversed) Intergenic
No off target data available for this crispr