ID: 1071055688

View in Genome Browser
Species Human (GRCh38)
Location 10:81505923-81505945
Sequence GCCAGCCGGCCCGCAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055686_1071055688 -9 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055680_1071055688 17 Left 1071055680 10:81505883-81505905 CCGGGTGAGCATGGGCTCAGCGG No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055685_1071055688 -8 Left 1071055685 10:81505908-81505930 CCCGTGCTCAGAGCGGCCAGCCG No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055677_1071055688 29 Left 1071055677 10:81505871-81505893 CCAGCGCGAGTTCCGGGTGAGCA No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data
1071055684_1071055688 -7 Left 1071055684 10:81505907-81505929 CCCCGTGCTCAGAGCGGCCAGCC No data
Right 1071055688 10:81505923-81505945 GCCAGCCGGCCCGCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055688 Original CRISPR GCCAGCCGGCCCGCAAGCCC TGG Intergenic
No off target data available for this crispr