ID: 1071055694

View in Genome Browser
Species Human (GRCh38)
Location 10:81505933-81505955
Sequence CCCTCACTGCCCAGGGCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055694_1071055703 23 Left 1071055694 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
Right 1071055703 10:81505979-81506001 GCTGTGCTCAATTTCTCACCAGG 0: 23
1: 160
2: 367
3: 531
4: 514
1071055694_1071055700 -9 Left 1071055694 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055694_1071055699 -10 Left 1071055694 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055694 Original CRISPR CCCTCACTGCCCAGGGCTTG CGG (reversed) Intergenic
No off target data available for this crispr