ID: 1071055699

View in Genome Browser
Species Human (GRCh38)
Location 10:81505946-81505968
Sequence GCAGTGAGGGGCTTAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2085
Summary {0: 554, 1: 662, 2: 423, 3: 218, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055691_1071055699 -5 Left 1071055691 10:81505928-81505950 CCGGCCCGCAAGCCCTGGGCAGT No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055689_1071055699 -1 Left 1071055689 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055694_1071055699 -10 Left 1071055694 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055686_1071055699 14 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055685_1071055699 15 Left 1071055685 10:81505908-81505930 CCCGTGCTCAGAGCGGCCAGCCG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055692_1071055699 -9 Left 1071055692 10:81505932-81505954 CCCGCAAGCCCTGGGCAGTGAGG No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228
1071055684_1071055699 16 Left 1071055684 10:81505907-81505929 CCCCGTGCTCAGAGCGGCCAGCC No data
Right 1071055699 10:81505946-81505968 GCAGTGAGGGGCTTAGCACCTGG 0: 554
1: 662
2: 423
3: 218
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055699 Original CRISPR GCAGTGAGGGGCTTAGCACC TGG Intergenic
Too many off-targets to display for this crispr