ID: 1071055700

View in Genome Browser
Species Human (GRCh38)
Location 10:81505947-81505969
Sequence CAGTGAGGGGCTTAGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2345
Summary {0: 394, 1: 579, 2: 635, 3: 434, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071055694_1071055700 -9 Left 1071055694 10:81505933-81505955 CCGCAAGCCCTGGGCAGTGAGGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055692_1071055700 -8 Left 1071055692 10:81505932-81505954 CCCGCAAGCCCTGGGCAGTGAGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055684_1071055700 17 Left 1071055684 10:81505907-81505929 CCCCGTGCTCAGAGCGGCCAGCC No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055685_1071055700 16 Left 1071055685 10:81505908-81505930 CCCGTGCTCAGAGCGGCCAGCCG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055689_1071055700 0 Left 1071055689 10:81505924-81505946 CCAGCCGGCCCGCAAGCCCTGGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055691_1071055700 -4 Left 1071055691 10:81505928-81505950 CCGGCCCGCAAGCCCTGGGCAGT No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303
1071055686_1071055700 15 Left 1071055686 10:81505909-81505931 CCGTGCTCAGAGCGGCCAGCCGG No data
Right 1071055700 10:81505947-81505969 CAGTGAGGGGCTTAGCACCTGGG 0: 394
1: 579
2: 635
3: 434
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071055700 Original CRISPR CAGTGAGGGGCTTAGCACCT GGG Intergenic
Too many off-targets to display for this crispr