ID: 1071067206

View in Genome Browser
Species Human (GRCh38)
Location 10:81650040-81650062
Sequence AGTTTCCAACTGTAACACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071067206_1071067211 19 Left 1071067206 10:81650040-81650062 CCTCTGTGTTACAGTTGGAAACT No data
Right 1071067211 10:81650082-81650104 GAGCTATAGGTCTCAAGGTTAGG No data
1071067206_1071067208 6 Left 1071067206 10:81650040-81650062 CCTCTGTGTTACAGTTGGAAACT No data
Right 1071067208 10:81650069-81650091 AACCTAGGAAGCTGAGCTATAGG No data
1071067206_1071067207 -9 Left 1071067206 10:81650040-81650062 CCTCTGTGTTACAGTTGGAAACT No data
Right 1071067207 10:81650054-81650076 TTGGAAACTGATAAAAACCTAGG No data
1071067206_1071067210 14 Left 1071067206 10:81650040-81650062 CCTCTGTGTTACAGTTGGAAACT No data
Right 1071067210 10:81650077-81650099 AAGCTGAGCTATAGGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071067206 Original CRISPR AGTTTCCAACTGTAACACAG AGG (reversed) Intergenic
No off target data available for this crispr