ID: 1071067210

View in Genome Browser
Species Human (GRCh38)
Location 10:81650077-81650099
Sequence AAGCTGAGCTATAGGTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071067206_1071067210 14 Left 1071067206 10:81650040-81650062 CCTCTGTGTTACAGTTGGAAACT No data
Right 1071067210 10:81650077-81650099 AAGCTGAGCTATAGGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071067210 Original CRISPR AAGCTGAGCTATAGGTCTCA AGG Intergenic
No off target data available for this crispr