ID: 1071070800

View in Genome Browser
Species Human (GRCh38)
Location 10:81691214-81691236
Sequence GTGACCAGGAGTAAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071070797_1071070800 -7 Left 1071070797 10:81691198-81691220 CCATTTCCTAAAATAAGTGACCA No data
Right 1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071070800 Original CRISPR GTGACCAGGAGTAAAACTGC TGG Intergenic
No off target data available for this crispr