ID: 1071079231

View in Genome Browser
Species Human (GRCh38)
Location 10:81790355-81790377
Sequence CCCTGACCGAGTAACATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071079228_1071079231 -1 Left 1071079228 10:81790333-81790355 CCCAAGAGATTCATCTTAATTTC No data
Right 1071079231 10:81790355-81790377 CCCTGACCGAGTAACATTTAAGG No data
1071079229_1071079231 -2 Left 1071079229 10:81790334-81790356 CCAAGAGATTCATCTTAATTTCC No data
Right 1071079231 10:81790355-81790377 CCCTGACCGAGTAACATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071079231 Original CRISPR CCCTGACCGAGTAACATTTA AGG Intergenic
No off target data available for this crispr