ID: 1071079990

View in Genome Browser
Species Human (GRCh38)
Location 10:81799297-81799319
Sequence AGGCTGAGGCTGCCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071079983_1071079990 25 Left 1071079983 10:81799249-81799271 CCATCTGGTTTGGAGCATCATTC No data
Right 1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071079990 Original CRISPR AGGCTGAGGCTGCCAGAGAC TGG Intergenic
No off target data available for this crispr