ID: 1071082706

View in Genome Browser
Species Human (GRCh38)
Location 10:81831312-81831334
Sequence CAGCAAATAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071082700_1071082706 13 Left 1071082700 10:81831276-81831298 CCAGAGGGGCGGAAGTCAGCGGC No data
Right 1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG No data
1071082695_1071082706 24 Left 1071082695 10:81831265-81831287 CCCTGCCAGATCCAGAGGGGCGG No data
Right 1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG No data
1071082698_1071082706 19 Left 1071082698 10:81831270-81831292 CCAGATCCAGAGGGGCGGAAGTC No data
Right 1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG No data
1071082697_1071082706 23 Left 1071082697 10:81831266-81831288 CCTGCCAGATCCAGAGGGGCGGA No data
Right 1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071082706 Original CRISPR CAGCAAATAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr