ID: 1071085214

View in Genome Browser
Species Human (GRCh38)
Location 10:81862190-81862212
Sequence GGTTCCCTCGAACACTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071085214_1071085223 30 Left 1071085214 10:81862190-81862212 CCTCCACAGTGTTCGAGGGAACC No data
Right 1071085223 10:81862243-81862265 CCTGCTTTTATTCTCTTATCTGG 0: 1028
1: 802
2: 405
3: 586
4: 545
1071085214_1071085220 4 Left 1071085214 10:81862190-81862212 CCTCCACAGTGTTCGAGGGAACC No data
Right 1071085220 10:81862217-81862239 CAGGTTGCCACTGCTGGCTCAGG 0: 101
1: 451
2: 802
3: 847
4: 812
1071085214_1071085218 -2 Left 1071085214 10:81862190-81862212 CCTCCACAGTGTTCGAGGGAACC No data
Right 1071085218 10:81862211-81862233 CCCAAGCAGGTTGCCACTGCTGG 0: 39
1: 238
2: 619
3: 830
4: 970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071085214 Original CRISPR GGTTCCCTCGAACACTGTGG AGG (reversed) Intergenic
No off target data available for this crispr