ID: 1071085279

View in Genome Browser
Species Human (GRCh38)
Location 10:81862624-81862646
Sequence GGCCCCAGTGCAGGATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071085279_1071085284 4 Left 1071085279 10:81862624-81862646 CCAGTGGATCCTGCACTGGGGCC No data
Right 1071085284 10:81862651-81862673 GTGGAGCTGCCTGCCAGTCCTGG 0: 50
1: 22
2: 10
3: 31
4: 215
1071085279_1071085285 5 Left 1071085279 10:81862624-81862646 CCAGTGGATCCTGCACTGGGGCC No data
Right 1071085285 10:81862652-81862674 TGGAGCTGCCTGCCAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071085279 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG (reversed) Intergenic
No off target data available for this crispr