ID: 1071086633

View in Genome Browser
Species Human (GRCh38)
Location 10:81874549-81874571
Sequence CGCCGCCGCGAGCCAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071086633_1071086642 21 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086642 10:81874593-81874615 GTTTGACTCTCCGGCGGCGGCGG No data
1071086633_1071086639 12 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086639 10:81874584-81874606 TTCGCTGGAGTTTGACTCTCCGG No data
1071086633_1071086638 -3 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086638 10:81874569-81874591 GCGACAGCGGCGCTGTTCGCTGG No data
1071086633_1071086643 27 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086643 10:81874599-81874621 CTCTCCGGCGGCGGCGGCAGCGG No data
1071086633_1071086640 15 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086640 10:81874587-81874609 GCTGGAGTTTGACTCTCCGGCGG No data
1071086633_1071086641 18 Left 1071086633 10:81874549-81874571 CCAGCCCCTGGCTCGCGGCGGCG No data
Right 1071086641 10:81874590-81874612 GGAGTTTGACTCTCCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071086633 Original CRISPR CGCCGCCGCGAGCCAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr