ID: 1071086676

View in Genome Browser
Species Human (GRCh38)
Location 10:81874767-81874789
Sequence GGAGCAGCCGCCGAAGATCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071086672_1071086676 -4 Left 1071086672 10:81874748-81874770 CCTCACCGCCCGGGCTCGCGGAG No data
Right 1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG No data
1071086668_1071086676 16 Left 1071086668 10:81874728-81874750 CCGGCTGAAGAACAGGTGCACCT No data
Right 1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG No data
1071086673_1071086676 -9 Left 1071086673 10:81874753-81874775 CCGCCCGGGCTCGCGGAGCAGCC No data
Right 1071086676 10:81874767-81874789 GGAGCAGCCGCCGAAGATCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071086676 Original CRISPR GGAGCAGCCGCCGAAGATCG CGG Intergenic
No off target data available for this crispr