ID: 1071087085

View in Genome Browser
Species Human (GRCh38)
Location 10:81876259-81876281
Sequence CCCCTCCCCCATCCCAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 602}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071087081_1071087085 -6 Left 1071087081 10:81876242-81876264 CCTGTTTTCTAGCAAGCCCCCTC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087080_1071087085 -3 Left 1071087080 10:81876239-81876261 CCGCCTGTTTTCTAGCAAGCCCC 0: 1
1: 0
2: 0
3: 17
4: 271
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087075_1071087085 21 Left 1071087075 10:81876215-81876237 CCCTCCTGCTGTCTTTTTCCCTC 0: 1
1: 0
2: 9
3: 137
4: 1426
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087073_1071087085 29 Left 1071087073 10:81876207-81876229 CCCTTCTGCCCTCCTGCTGTCTT 0: 1
1: 0
2: 6
3: 103
4: 889
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087076_1071087085 20 Left 1071087076 10:81876216-81876238 CCTCCTGCTGTCTTTTTCCCTCG 0: 1
1: 0
2: 3
3: 30
4: 326
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087078_1071087085 3 Left 1071087078 10:81876233-81876255 CCCTCGCCGCCTGTTTTCTAGCA 0: 1
1: 0
2: 0
3: 19
4: 648
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087079_1071087085 2 Left 1071087079 10:81876234-81876256 CCTCGCCGCCTGTTTTCTAGCAA 0: 1
1: 0
2: 0
3: 9
4: 249
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087074_1071087085 28 Left 1071087074 10:81876208-81876230 CCTTCTGCCCTCCTGCTGTCTTT 0: 1
1: 0
2: 7
3: 82
4: 781
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602
1071087077_1071087085 17 Left 1071087077 10:81876219-81876241 CCTGCTGTCTTTTTCCCTCGCCG 0: 1
1: 0
2: 1
3: 18
4: 116
Right 1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG 0: 1
1: 0
2: 7
3: 71
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071087085 Original CRISPR CCCCTCCCCCATCCCAGGTT TGG Intronic
900092609 1:926946-926968 CCCCTCCCCCATCCTACCTCAGG - Intronic
900473729 1:2866657-2866679 CTCCTCCCCCTGCCCAGGTGAGG - Intergenic
900594524 1:3474654-3474676 CCCCTCTGGCATCCCAGGTGTGG - Intronic
900872253 1:5312388-5312410 CCCCTGCCCCTTCCCAGGCCTGG + Intergenic
900887708 1:5427253-5427275 CCCCTCCCCCATCCTGGTTCTGG + Intergenic
901782463 1:11602855-11602877 CCCTTCCCCCATCACATGGTGGG - Intergenic
902530837 1:17089712-17089734 CCCGTCCTCCATCCCTGGCTCGG + Intronic
902700643 1:18169619-18169641 CCCTGCCCCCAGCCCAGGGTAGG + Intronic
902728401 1:18352405-18352427 ACCCCACCCCATCCCAGGTTGGG + Intronic
903557246 1:24202857-24202879 CCCATCCCCTATCACAGGGTAGG - Intergenic
903646040 1:24897080-24897102 CCCCTCACCCCTCCCAGCTCTGG + Intergenic
903685416 1:25128153-25128175 CCCCTCCCCAAGCCCAGATCTGG + Intergenic
903971885 1:27124168-27124190 CCTCTGCCCCACCCCAGGTGTGG - Intronic
904044445 1:27601706-27601728 CTACCCCCCCACCCCAGGTTGGG + Intronic
904868723 1:33602849-33602871 CCCCTCTCCCTTCCCAGGAATGG + Intronic
904941196 1:34165824-34165846 CTCCTACCCCATCCCAGGAGAGG + Intronic
905037804 1:34929308-34929330 CCCCTCCCCCCTCCCGGGGCCGG + Intronic
905040978 1:34958071-34958093 CCCCTCCCCCACCCCACGACAGG - Intergenic
905169606 1:36101547-36101569 CCCCTTCCCCTTCCCAGCTGTGG + Intronic
905478255 1:38244072-38244094 CCTCACCCCCAGCCCAGGCTGGG + Intergenic
905481710 1:38266257-38266279 CCCCTCCCCCACCCCACGACAGG + Intergenic
906203923 1:43976877-43976899 ACTCTCCCCCATCCCAGCTTGGG + Intronic
906297926 1:44660323-44660345 CCCCGCCCCCACCCCAGCTCTGG - Intronic
906314101 1:44775369-44775391 CCCTTCCCCCAGCCCAGGGTCGG + Intronic
906513732 1:46425880-46425902 CACCACGCCCCTCCCAGGTTGGG - Intergenic
907564191 1:55419352-55419374 CTCATCCCCCACCCCAAGTTGGG - Intergenic
907708220 1:56851366-56851388 CCCCTCCCCCATCCCAGTGCAGG + Intergenic
907853063 1:58274819-58274841 CCCCTCGCGCTTCCCAGGTGAGG + Intronic
908100183 1:60782805-60782827 CCCCTCCCCCACCCCATGACAGG - Intergenic
908370323 1:63473551-63473573 CCCCTCCCCCCTCCCAGATGGGG - Intronic
910045585 1:82910360-82910382 CCCTACCCCCACCCCAGTTTTGG + Intergenic
910266911 1:85347609-85347631 ACCCTCCCCCATCCCACGACAGG - Intronic
910701784 1:90083014-90083036 CCCCTGCCAAAACCCAGGTTTGG - Intergenic
911316209 1:96359501-96359523 CCCCCACCCCTTCCCAGGTTTGG - Intergenic
911490733 1:98563013-98563035 AGCCTCCCCCATCACAGGTCTGG + Intergenic
912430259 1:109625090-109625112 CCCCTCACCCATTCCAGGCTTGG - Intronic
912511338 1:110192256-110192278 CCCCTGCCCACTCCCAGGTAAGG - Intronic
912584806 1:110752784-110752806 CCCTTCCCCCACCCCAGGACAGG + Intergenic
912751786 1:112293567-112293589 CCCCTCCCCCCTCCCGGACTGGG - Intergenic
913018356 1:114762592-114762614 CCCCTCCCCCATCCCACGACAGG - Intergenic
913430182 1:118781546-118781568 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
913612536 1:120522242-120522264 CCCTTTCCACATCCCAGTTTTGG - Intergenic
913993854 1:143638060-143638082 CCCCTCCCCCCTCCCGGACTGGG - Intergenic
914578655 1:149000005-149000027 CCCTTTCCACATCCCAGTTTTGG + Intronic
914871506 1:151478829-151478851 CCGCCCCCCCATCCCAGGTCTGG + Intergenic
914899044 1:151702336-151702358 TCCCTCCCCCTTCCCAGTGTGGG + Intergenic
915064207 1:153211166-153211188 CACCACCCCATTCCCAGGTTGGG + Intergenic
915309895 1:155001679-155001701 CCCCTCCCCCTTCGCAGACTGGG + Intergenic
915707500 1:157860623-157860645 CCCCTCCCCCACCCCATGACAGG + Intronic
915771848 1:158433311-158433333 CCCCTTACCCTTCCCAGGTGAGG + Intergenic
915927342 1:160032691-160032713 CCCCTCCCCTGTCCGAGGATAGG + Intergenic
916635794 1:166667161-166667183 CCCTTCCCCCACCCCACGATGGG - Intergenic
919002644 1:191853392-191853414 CCCCTCCCCCAACCCATGACAGG + Intergenic
919308822 1:195878744-195878766 AGCCTCCCCCATCACAGGTTTGG - Intergenic
919325805 1:196105327-196105349 CCTCTCCCCCATCCCACGACTGG - Intergenic
919797430 1:201329675-201329697 CCCCACCCCAATCCCTGGTGGGG + Intronic
919836851 1:201580831-201580853 CCCCAACCCCATCCCAAGTAGGG - Intergenic
919845505 1:201639773-201639795 CCCCGTCCCCATCCCAGCTTGGG + Intronic
920032393 1:203045293-203045315 CCACTCCCCTATCCCAGGGGTGG - Intronic
920237260 1:204516457-204516479 CCCCTCCCCCCACCCGGGCTCGG + Exonic
920916504 1:210262104-210262126 CCCTTCACCCAGCCCAGGTGCGG - Intergenic
921004710 1:211081811-211081833 CCCGTCCCCCATCCCATGACAGG - Intronic
921292367 1:213670612-213670634 ACCCTCCCCCAGGCCAGGATAGG + Intergenic
922799540 1:228358930-228358952 CTCCTCCCCCATCCCATTTTGGG + Intronic
922950826 1:229557987-229558009 CCCCTCCCTCCTCCGGGGTTAGG + Intronic
922985665 1:229864302-229864324 CCCTTCTCCCTTCCCAGGCTGGG - Intergenic
923418697 1:233790945-233790967 CCCCACCCCCACCCCAGGAAAGG + Intergenic
924672897 1:246147533-246147555 CCCCTGCCCCAACCCAGAATGGG - Intronic
1062832892 10:617659-617681 CCCCACCCCCACCCCTGCTTGGG + Intronic
1063551462 10:7037790-7037812 CCCCTCCCCCATCCCACAACAGG - Intergenic
1063944368 10:11162595-11162617 CACCCCCCCCACCCCAGTTTAGG - Intronic
1065088578 10:22206030-22206052 CCCCTCCCCTATCCCCTGTCTGG + Intergenic
1065919012 10:30374629-30374651 CCCCTCCCCTCTCCCAGAGTGGG - Intergenic
1066159069 10:32709314-32709336 CCCCTCCCCCCACCCACGATAGG - Intronic
1067082222 10:43218238-43218260 CCCCTCCCTCATCCCACTTCTGG + Intronic
1067808903 10:49411944-49411966 CCCCACCTCCTTCCCAGCTTAGG - Intergenic
1068962925 10:62883446-62883468 CCCCACCCCCTTCTCAGGTTTGG + Intronic
1068969622 10:62947805-62947827 CCCCTCCCCCCTCCCGGACTGGG - Intergenic
1069569223 10:69484416-69484438 CCCATGCCCCATCCCAGAATGGG - Intronic
1069881589 10:71596919-71596941 CCCTTCCTCCCTCCCAGGTTGGG + Intronic
1070264156 10:74886391-74886413 CCCCACCTGCATCCCAGGTGAGG + Intronic
1070351134 10:75593142-75593164 TCCCTCCCCCATCCCAACGTTGG + Intronic
1070658767 10:78289842-78289864 TCACTCCCCCATGCCAGGTGGGG + Intergenic
1070735620 10:78861823-78861845 CCCCTCGCCCTTCCCAGGATTGG - Intergenic
1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG + Intronic
1071244444 10:83747138-83747160 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
1071587665 10:86840886-86840908 CCCCTTCACCATCCAAGTTTAGG + Intronic
1071756435 10:88546022-88546044 TCCCTCCCCCCTACCAGTTTAGG - Intronic
1072770261 10:98132075-98132097 CACCTGCCCCAGCCCAGATTGGG - Intergenic
1073800732 10:107038678-107038700 CCCCGCCCCCTGCCCAGGGTTGG - Intronic
1074054980 10:109914937-109914959 CTCCACCCCAACCCCAGGTTGGG - Intronic
1074536711 10:114333163-114333185 ACCTTCCCCCATCCCAGGAGTGG + Intronic
1074841452 10:117356705-117356727 CCTCTCCCCAACCCCAGATTAGG - Intronic
1074861606 10:117514321-117514343 TACCTCCCTCCTCCCAGGTTGGG + Intergenic
1075170555 10:120109735-120109757 CCCCTCCCCCACCCCACGACAGG + Intergenic
1075914265 10:126153997-126154019 CCCAGCCCCCATCCCTGGATTGG + Intronic
1076300942 10:129425815-129425837 CCCTTCCCCCACCCCAGTCTTGG - Intergenic
1076372969 10:129966905-129966927 CCCCTTCCCCATCCCTGGCCTGG - Intergenic
1076777871 10:132708079-132708101 CCCCCACCCCACCCCAGGCTGGG + Intronic
1077187752 11:1243066-1243088 CCCCTCCTCCAGCCCAGGGACGG + Exonic
1077188174 11:1244737-1244759 CCCCTCCTCCAGCCCAGGGACGG + Exonic
1077188708 11:1246837-1246859 CCCCTCCTCCAGCCCAGGGACGG + Exonic
1077189128 11:1248508-1248530 CCCCTCCTCCAGCCCAGGGACGG + Exonic
1077189693 11:1250692-1250714 CCCCTCCTCCAGCCCAGGGACGG + Exonic
1077582366 11:3424580-3424602 ACCCAGACCCATCCCAGGTTAGG - Intergenic
1077634749 11:3834766-3834788 CCCCTCCCCCACTCCCAGTTGGG - Intronic
1077702011 11:4451021-4451043 CCCATCCCCTATCACAGATTTGG - Intergenic
1077981939 11:7309573-7309595 AGCCTCCCCCACCCCAGGTGAGG - Intronic
1078325869 11:10380369-10380391 TCCTTCCCCCATCCCAGGCATGG - Intronic
1078501590 11:11884834-11884856 ACCCACCCCCATCCCTGGTGTGG - Intronic
1078664557 11:13313889-13313911 CCCCACCCCCACCCCACTTTGGG + Intronic
1078758358 11:14232569-14232591 CCACTCCTCCCTCCCAGGTCTGG + Intronic
1079177595 11:18157355-18157377 CCCCTCCCCCACCCCACGACAGG - Intronic
1079681582 11:23303980-23304002 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
1080390682 11:31843053-31843075 GCCTTCCCTGATCCCAGGTTTGG + Intronic
1081670768 11:44941219-44941241 CCCCTCCCCCGGCCAAGGCTGGG - Intronic
1081904540 11:46659469-46659491 CCTCCCCACCATCCCAGGTAGGG + Exonic
1081997636 11:47375587-47375609 CCCATCCCCCAGCCCAGCCTGGG - Intronic
1083272630 11:61580096-61580118 GCCCTCCCCCACCCCAGGACGGG + Intronic
1083335409 11:61918957-61918979 CCCCACCCCCAGCCCAGCTCAGG + Intronic
1083439700 11:62667742-62667764 CTCTTCCTCCATCCCAGGCTGGG - Exonic
1083654660 11:64223672-64223694 CCCCACCCCCATCCCTGGCCTGG - Exonic
1083880386 11:65545515-65545537 CCCCTCCCCGTTTCCAGTTTGGG - Intronic
1084089193 11:66869235-66869257 GCCCCCACCCATCCCAGGCTCGG + Intronic
1084168231 11:67387062-67387084 CCCCTCATCCACCCCAGCTTGGG - Intronic
1084327907 11:68412304-68412326 CCCATCCCCCCTGCCAAGTTGGG + Intronic
1084526333 11:69700759-69700781 CCCCTCCCCCAGGCCAGGCCAGG + Intronic
1085076590 11:73597657-73597679 CCACTCTCCTGTCCCAGGTTGGG + Intronic
1085292436 11:75410076-75410098 CCCCTCCCCCCTCCCGGACTGGG + Intronic
1085450728 11:76630525-76630547 CCCTTCCCCCACCCCAGCCTTGG + Intergenic
1085463523 11:76709400-76709422 CCCCTGCCCCAGGCCAGGCTAGG + Intergenic
1086334126 11:85782386-85782408 CCCCCCACCCATCACAGGTCTGG - Intronic
1086567800 11:88246452-88246474 CCCCTCCCCCATCCCACAAAAGG - Intergenic
1086628968 11:88992860-88992882 CCCCTCCCCCACCCCACGACAGG - Intronic
1087268176 11:96083618-96083640 CCCCTCCCCCAACAGAAGTTAGG - Intronic
1087393326 11:97567179-97567201 CCCCTCCTCCATCACCGCTTAGG - Intergenic
1088078713 11:105883424-105883446 CCCCTCCCCCACCCCACGGCAGG + Intronic
1089128782 11:116195628-116195650 CCCCTCAACCCACCCAGGTTAGG - Intergenic
1089190337 11:116648937-116648959 CCCTTCCCTCTTCCCAGGCTCGG - Intergenic
1089395794 11:118135867-118135889 CTCCTCCCCAACCCCAGGGTGGG + Exonic
1089566042 11:119372351-119372373 CCCCGCATCCAGCCCAGGTTGGG + Intronic
1090688797 11:129155950-129155972 CCCCTTGCCCTTCCCAGGTGAGG - Intronic
1091645410 12:2268966-2268988 CCCCACCCCCTGCCCAGGGTCGG + Intronic
1091789860 12:3265714-3265736 CACCTCCCCCAACTCAGGTTGGG + Intronic
1092180339 12:6442589-6442611 CCTCTCCCCCATGCCTGGCTGGG - Intergenic
1092638816 12:10481548-10481570 CCCCTTCCACTTCCCAGGTGAGG - Intergenic
1093275593 12:17121122-17121144 CCCTTCCCCCACCCCACGATAGG - Intergenic
1093694314 12:22142794-22142816 CCCCTCCCCCACCCCACGACAGG - Intronic
1093988493 12:25564086-25564108 CCCCTCGCGCTTCCCAGGTGAGG + Intronic
1094427292 12:30328395-30328417 CCCCTCCCTCATGCCAGGGAGGG + Intergenic
1095805348 12:46312983-46313005 CCCCTTGCGCTTCCCAGGTTAGG + Intergenic
1096098838 12:48956830-48956852 CCCCTCCCCCATCATAGGGCAGG - Intronic
1096459643 12:51814949-51814971 CCCCTCCCCCATCACCGGCGCGG - Intergenic
1096515292 12:52152285-52152307 CCCCTCCCCTACCCCAGGCGGGG + Intergenic
1096515609 12:52153571-52153593 CCCCTTCCCAAGCCCAGGTCTGG + Intergenic
1096628062 12:52907310-52907332 CGCCTTCCCTGTCCCAGGTTTGG - Intronic
1096671195 12:53199203-53199225 ACCTGCCCCCATCCCAGCTTGGG + Intronic
1097191414 12:57221295-57221317 CCCCTTCCCCAGCCCAGGCCTGG + Intronic
1097410975 12:59252886-59252908 CCCCTCCCACATCACAGGCCTGG + Intergenic
1098430751 12:70417395-70417417 CACCTGCCCCATCCCTGTTTAGG - Intronic
1099001113 12:77179211-77179233 CCCCTCGCGCTTCCCAGGTGAGG + Intergenic
1100568365 12:95820940-95820962 CCCCTCCCCCACCCCATGACAGG + Intronic
1102518942 12:113467416-113467438 CCCCTCCTCTGTCCCAGGTGTGG - Exonic
1103272727 12:119687263-119687285 CCTCTTCCCCATCCCAGAGTGGG + Exonic
1103361801 12:120358971-120358993 CCCCTCCCCCTTCCCAGGCTGGG - Intronic
1103363490 12:120367673-120367695 TCCCTCCCCCAGCCCAAATTGGG - Intronic
1104667934 12:130660671-130660693 CTGCGCCCCCACCCCAGGTTCGG + Intronic
1104758773 12:131284690-131284712 TCCCTCCCCCACCCGAGGTTCGG + Intergenic
1104821828 12:131681835-131681857 TCCCTCCCCCACCCGAGGTTCGG - Intergenic
1104958548 12:132477432-132477454 CCCCTCCCCCACCACAGCTGAGG + Intergenic
1104973967 12:132543853-132543875 CCCCACCTCCATCCCGGGCTGGG - Intronic
1106831357 13:33586798-33586820 CCCCTGCCCCATCCTAACTTGGG + Intergenic
1107093783 13:36512916-36512938 CCCCTCCCCCCACCAATGTTAGG - Intergenic
1107482336 13:40795132-40795154 CCCCTCCCCCATGCCACACTGGG + Intronic
1108457211 13:50628526-50628548 CCCCTCCCCCACCCCATGACAGG + Intronic
1108499792 13:51059641-51059663 CCTCTCCCCCAACCCACGTGAGG + Intergenic
1110137550 13:72086641-72086663 CACCTCCCCCACCCCATGATAGG - Intergenic
1110491933 13:76119498-76119520 CCTCTCTCTCATCACAGGTTTGG - Intergenic
1110812764 13:79828771-79828793 CCCCTCCCCCATCCCATGACAGG - Intergenic
1112051015 13:95644079-95644101 TCCCTCCCCCATCCCGGGCAGGG + Intronic
1112292508 13:98157325-98157347 CCCCTCCCCCATGCTAGTCTAGG + Intronic
1112495786 13:99903329-99903351 CTCCTCCCCCATCCCAGCAGAGG + Intergenic
1112664579 13:101554736-101554758 CCCCTGCCCCACCCCAGGAGGGG - Intronic
1113403525 13:110017733-110017755 CCCCATTCCCATCTCAGGTTCGG + Intergenic
1113945094 13:114039552-114039574 ACCCTCCCACGTCCCAGGGTTGG + Intronic
1114003839 14:18289651-18289673 CCCCTTGCGCTTCCCAGGTTAGG + Intergenic
1114260958 14:21035843-21035865 CACCTCCCCAATCCCAGCTACGG + Intronic
1114517022 14:23306903-23306925 CCCCGCCCGCCTGCCAGGTTAGG - Intronic
1114660428 14:24340033-24340055 CCCCTGCCCCACCCCAGGGGCGG - Exonic
1114666073 14:24377852-24377874 CCCCTCCCCCAGCTGAGGTGTGG + Exonic
1117807857 14:59513373-59513395 CCCCTTCCACTTCCCAGGTGAGG - Intronic
1118382087 14:65225777-65225799 CTTCTCCCCCATCCCAGCTCAGG + Intergenic
1118849641 14:69573813-69573835 CCCCACCCCCATCCCCGTTCTGG - Intronic
1119110795 14:71972145-71972167 TCCCTCCCCCAGCCCAATTTTGG + Intronic
1119560741 14:75587549-75587571 TCCCTCCCTCATCCCAGCTCTGG - Intronic
1119925145 14:78486567-78486589 CTCTTCCACCATCCCAGGGTGGG - Intronic
1120149228 14:81014508-81014530 CCCCTTCTCCATCTCAGGTTTGG + Intronic
1120742378 14:88122353-88122375 CCACTCCCCCATCCCATGAGAGG + Intergenic
1121432006 14:93894188-93894210 CCCCTTTCCCCTCCCAGGCTGGG + Intergenic
1122751564 14:103937614-103937636 CCCCTCCCCCATCCCAAGGGGGG + Intronic
1122772316 14:104102903-104102925 CCCCTCCCCACACCCAGGGTGGG - Intronic
1122836026 14:104431567-104431589 CCCCACCTCCACCCCAGGATGGG + Intergenic
1123008949 14:105338055-105338077 CCCCGCCCCCATCTGAGGCTGGG + Intronic
1124207116 15:27730525-27730547 CCCCTCCCCATTCCCAAGGTTGG + Intergenic
1124956334 15:34362909-34362931 CCCCTTCCCCAACCCAGGTGGGG + Intronic
1125210243 15:37206367-37206389 CCCTCCCCCCATCCCACGATAGG - Intergenic
1125330877 15:38580907-38580929 CCCCTTCCACTTCCCAGGTGAGG - Intergenic
1125725710 15:41867156-41867178 GCCCTGCCCCAGCCCAGGGTGGG - Intronic
1125811695 15:42547818-42547840 TCCATCCCCCATTCCAAGTTAGG + Intronic
1126781635 15:52144023-52144045 CACCTCCCACATGCCAGGGTGGG + Intronic
1127028298 15:54833083-54833105 CCCCTTCCCCCTCCCATGCTGGG + Intergenic
1127253862 15:57271302-57271324 CCCCTCCCCCTGCCAAAGTTAGG + Intronic
1128242646 15:66111564-66111586 CCCCACCCCCAGCGCAGGCTGGG + Intronic
1128515544 15:68339639-68339661 CCCCTCCCCAATGCCAGGATGGG - Exonic
1128691550 15:69727973-69727995 CCCCTCCCCTTTCCAGGGTTTGG + Intergenic
1129028954 15:72604920-72604942 CCCCTCCCCTCTCCCAGAGTGGG + Intergenic
1129474379 15:75775323-75775345 CCCCTCCCCTCTCCCAGAGTAGG + Intergenic
1129515548 15:76154954-76154976 CCCCTTCCCAACCCCATGTTCGG + Intronic
1130268283 15:82429790-82429812 CCCCTCCCCTCTCCCAGAGTGGG + Intergenic
1132300314 15:100771275-100771297 TCCCTCCCTCTTCCCAGGTGTGG + Intergenic
1132434091 15:101782310-101782332 CCCCTCCCCTGTCCCAGAGTGGG - Intergenic
1132713553 16:1279649-1279671 CCCAACACCCATCCCTGGTTTGG - Intergenic
1132713844 16:1280840-1280862 CCCAACACCCATCGCAGGTTGGG - Intergenic
1136617666 16:31408548-31408570 CCCAGCCCCCAGCCCAGGGTGGG - Intronic
1136716711 16:32288067-32288089 CCCCACCCACATCCCTGGTGAGG - Intergenic
1136835087 16:33494312-33494334 CCCCACCCACATCCCTGGTGAGG - Intergenic
1137621361 16:49878522-49878544 CCCCTCCCCCAACCCACGACAGG + Intergenic
1137785257 16:51133232-51133254 CCCCACCCCCACCCCCGGTCTGG - Intergenic
1138029757 16:53550920-53550942 GCCTTCCCCAATCCCAGGCTGGG + Intergenic
1138212233 16:55173299-55173321 TCCTTCCCCCTTCACAGGTTGGG - Intergenic
1138608330 16:58103207-58103229 CCCCTGCCCTCTCCCACGTTGGG - Intergenic
1138873290 16:60919059-60919081 CCCCTGCCCTCTCTCAGGTTAGG + Intergenic
1138929268 16:61632752-61632774 CCCCTCCCCCATCCCACAACAGG + Intergenic
1139271748 16:65690190-65690212 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
1139591278 16:67934666-67934688 TCCCTCCTCCCTCCCAGGTCTGG - Exonic
1139797984 16:69498387-69498409 CCCCACCCCCACCGCAGATTGGG - Intergenic
1139864277 16:70051311-70051333 CCCCTCCCCCCTCCCGGACTGGG - Intergenic
1140061291 16:71572073-71572095 CCCCACCTCCACCCCAGGCTTGG + Intronic
1141749398 16:85948161-85948183 CACCTCCCCGCTCCCAGGTGAGG - Intergenic
1141959504 16:87395033-87395055 CCCCTCCCCCAGGCCAGGCGTGG - Intronic
1141998298 16:87648653-87648675 CCCCTCTCCCAGCCCAGGGCCGG - Intronic
1203009716 16_KI270728v1_random:229720-229742 CCCCACCCACATCCCTGGTGAGG + Intergenic
1203145259 16_KI270728v1_random:1794633-1794655 CCCCACCCACATCCCTGGTGAGG - Intergenic
1142826776 17:2517767-2517789 CCTCTTCCCCACCCCAAGTTAGG - Intergenic
1143203323 17:5127015-5127037 CCCCTCCCCCCACCCTGGTGCGG - Intronic
1143204701 17:5133627-5133649 CCACCCCCCCACCCCAGGGTGGG - Intronic
1144511593 17:15881799-15881821 CCCCTACCCCATCCTAGTTCAGG + Intergenic
1144874490 17:18390340-18390362 CCCCTCCCCCCACCCTGGTGCGG - Intergenic
1145245872 17:21268996-21269018 CCCCATCCTCAGCCCAGGTTGGG + Intergenic
1145792879 17:27638850-27638872 CCCCTCCTCCCTCCCAAGGTGGG + Intronic
1145807743 17:27746719-27746741 CCCCTCCTCCCTCCCAAGGTGGG + Intergenic
1145970779 17:28955330-28955352 CCCTACCCCCACCTCAGGTTGGG - Exonic
1146056640 17:29584670-29584692 CCCCACCCCCACCCCAGGACAGG - Intronic
1146339506 17:32007342-32007364 CCTCGCCCCCTTCCCAGGCTGGG + Intergenic
1146526593 17:33572301-33572323 CACCCCCCCCACCCCAGGGTAGG + Intronic
1146539786 17:33684310-33684332 CCCCCTCCCCACCCCAGGGTCGG - Intronic
1146739584 17:35270777-35270799 TCCCTCCCCTACCCCAGGGTTGG + Exonic
1147164085 17:38584248-38584270 CCCCAACCCCATCCCTGGGTTGG - Intronic
1147167856 17:38602930-38602952 CCCCACCCCCACCCCAGGTTAGG - Intronic
1147325205 17:39666670-39666692 CCCCACCCCCACCCCAAGTATGG - Intergenic
1147917549 17:43897768-43897790 CTCCTCACCCACCCCAGGCTGGG + Intronic
1147976186 17:44249521-44249543 CCCCACCCCCACCCCAGGGCAGG + Exonic
1148486567 17:47994895-47994917 CTCCTCCCCCAGCCCAGCCTGGG + Intergenic
1148488223 17:48005077-48005099 CCCCGCCCCCATTCCAGGAGAGG - Intergenic
1148559408 17:48597381-48597403 CCCCTCTCCCAGCCCTGGTAGGG - Intronic
1148733154 17:49850185-49850207 CCCCTCCCCCCACCCAATTTCGG + Intergenic
1148738660 17:49879741-49879763 CCCCTCCCCCTGCCCAGCCTTGG - Intergenic
1148756866 17:49977721-49977743 CCCCACCCCCACCTCAGATTTGG - Intergenic
1148792786 17:50183125-50183147 CGGCTCCCCCATCTCAGGTAAGG - Intergenic
1148809118 17:50279124-50279146 CCACTCCCCCATCCCAGCTGAGG - Intronic
1148858272 17:50590913-50590935 ACCCTCGCCCATCCCAGGCCTGG - Intronic
1149528892 17:57379324-57379346 CATCTCCCCCAGCCCAGGGTGGG - Intronic
1150280830 17:63928935-63928957 TGCCTCCCCCATCCCATGTGTGG + Exonic
1150527417 17:65937724-65937746 CCCCACCCCCCTCCCAGACTGGG - Intronic
1150913763 17:69414957-69414979 CCCCTCCCCCATCAAAGGAAAGG + Exonic
1151352079 17:73537652-73537674 CTCCTCCTACATCCCAGGCTGGG - Intronic
1151370622 17:73644492-73644514 CCCCTCCCCGCCCCCTGGTTGGG + Intergenic
1151500286 17:74483922-74483944 TCCCTCCTCCATCCTATGTTGGG + Intronic
1151684034 17:75636433-75636455 CCCCTTTCCCTTCCTAGGTTTGG - Intronic
1151891794 17:76955463-76955485 CCCCTCCCCACTCACAGGTGAGG + Intergenic
1151954599 17:77374061-77374083 CCCCTCCCCCACGCCAGTTTCGG + Intronic
1151972550 17:77466337-77466359 CCCCTTCCCCCTCCCAGCCTTGG + Intronic
1152229389 17:79106900-79106922 CCTCTCCCCCATCCCTGGGCTGG + Intronic
1152419673 17:80185662-80185684 CCTTTCCCCCAGCCCAGGGTCGG + Intronic
1152521459 17:80859052-80859074 CGCCTCTCCCAACCCAGGCTTGG - Intronic
1152678305 17:81652987-81653009 CCCCTCCTCCATCCCTGCTCAGG + Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1152926525 17:83090171-83090193 CCCCTGCCCCGCCCCAGGGTGGG + Intronic
1203163431 17_GL000205v2_random:72567-72589 CCCCTCCCCCATCCCACAACAGG + Intergenic
1153290592 18:3498592-3498614 CCCCACCCCCAGGCCAGGCTTGG + Exonic
1153561437 18:6375502-6375524 CACCACCCCGATCCCAGGCTAGG + Intronic
1153583646 18:6599829-6599851 CCCCTCCCCCGCCCCAGGGAAGG + Intergenic
1153887783 18:9482475-9482497 CCCCTCACCCATCCAGGGGTGGG - Intronic
1154284991 18:13046191-13046213 CACCTTCCCCATCCCTGCTTTGG - Intronic
1154490635 18:14919432-14919454 CCTCTGCCACATCCCAGGTAAGG + Intergenic
1155047530 18:22115834-22115856 TCACTCCCCCATCCCAGCCTAGG - Intergenic
1155096257 18:22559347-22559369 CCCCTCCCCGCCCCTAGGTTAGG - Intergenic
1156119196 18:33821174-33821196 TCCCTCCCCCATCTCACCTTTGG + Intergenic
1157274049 18:46297754-46297776 CCCCCTCCCCACCCCAGGCTGGG + Intergenic
1157297572 18:46457296-46457318 CCCCTCCCGCCTCCCAAATTGGG - Exonic
1157386674 18:47263813-47263835 CCCTTCCCCCACCCCAGCTAAGG - Intergenic
1157609326 18:48946412-48946434 CCCCGCCCCCCTCACAGGTCTGG - Intronic
1157616102 18:48988706-48988728 CTCCTCCCCCAGCTCAGGCTGGG - Intergenic
1159822695 18:73166140-73166162 CCCCTCCCCCATCCCACAACAGG + Intronic
1159956182 18:74519871-74519893 AGCATCCCCCATCCCAGCTTGGG - Intronic
1160086029 18:75778271-75778293 CCCCTCCCCCAGCACAGGGAGGG - Intergenic
1160160489 18:76466675-76466697 CCTCACACCCATCCCAGGCTTGG - Intronic
1160196593 18:76760234-76760256 CCCCTCCCCCACCCCATGTCAGG + Intergenic
1160537543 18:79603144-79603166 CCCCCACCCCTTCCCCGGTTGGG - Intergenic
1160846392 19:1167999-1168021 CCCCTCCCCCAGCTCTGGTGAGG - Intronic
1160874735 19:1291702-1291724 GCCCACCCCCACCCCAGTTTTGG + Intronic
1160952018 19:1672204-1672226 CACCTCCCCCAGCGCAGGGTGGG - Intergenic
1161099817 19:2416021-2416043 CTCCTCCCCCTCCCCTGGTTAGG - Intronic
1161126538 19:2561093-2561115 TCCCTCCCCCATTCAAGGTGTGG + Intronic
1161134638 19:2612459-2612481 CCCCTCCCCTCTCCCAGGCTGGG - Intronic
1161225988 19:3146200-3146222 CCCCTCTCCCATCGCTGGTTGGG + Intronic
1161337373 19:3721808-3721830 CCCCTCCCCCAGCCCGGGGTGGG + Exonic
1161489944 19:4556340-4556362 CTTCTCCTCCATCCCAGGTTAGG - Intronic
1161508943 19:4659877-4659899 CGCCACCCCCATCCAAGGGTGGG - Intronic
1161800243 19:6413481-6413503 CCCGTCCCCCCTCCCAGGACTGG - Exonic
1162180622 19:8866352-8866374 CTCCTCCCCTATCCCAGTTCAGG + Intronic
1163276801 19:16289863-16289885 CCCCACCCCCAACCCAGGTAGGG + Intergenic
1163491272 19:17618386-17618408 ACCCCTCCCCATCCCAGGTGGGG - Intronic
1163583882 19:18153767-18153789 CCCCTCCCGCCTCCCGGATTCGG + Intronic
1164909374 19:31993038-31993060 CCCCTCACACATGCCAGGTCAGG + Intergenic
1165067945 19:33240035-33240057 CCCCTCCCCCATCTAAAGTGGGG + Intergenic
1165170403 19:33888092-33888114 CCCCTCGCCCAGCTCAGGGTTGG + Intergenic
1166333895 19:42093968-42093990 CCACTCCTCCGTCCCAGGATGGG + Intronic
1166760098 19:45218662-45218684 CCCCTCCCCCATCCCTCACTTGG - Intronic
1166850147 19:45756062-45756084 ACCCAGCCCCATCCCAGGTAAGG + Exonic
1166855451 19:45780849-45780871 CCCCTCCCCCGCCCCAGGCCTGG + Intronic
1167383128 19:49149885-49149907 CCACTCCCCCTTCCCAGGGCGGG + Intronic
1167409533 19:49336892-49336914 CCCCTCACCTCTCCCAGGCTTGG + Exonic
1167593920 19:50417772-50417794 CCCCACCCCTCTCCCAGGCTGGG + Intronic
1168369786 19:55822591-55822613 CCCCTCGCGCTTCCCAGGTGAGG - Intronic
926498336 2:13619472-13619494 CCCTTCCCCCACCCCAGGACAGG - Intergenic
926842405 2:17096794-17096816 CCCCTCCCCCATCCCACGACAGG + Intergenic
927031625 2:19125842-19125864 CCCCTCCCTCCTCCTAGTTTTGG - Intergenic
927178166 2:20424774-20424796 CCCCGCCCCCAAACCAGCTTTGG + Intergenic
928511253 2:32006092-32006114 CCCCTACCCCAACCCAGTTTTGG - Intronic
928558024 2:32447661-32447683 CCCCTCCCCCCTCCCGGACTGGG + Intronic
928598490 2:32880287-32880309 CCCCTCCCCCACCCCATGACAGG - Intergenic
929145643 2:38705170-38705192 CCCTTCCTCCAGCCCAGGTCTGG + Intronic
929396705 2:41531894-41531916 CCAGTCCCCCACCCCAGGTAGGG + Intergenic
929666533 2:43838330-43838352 CCCCTCCCCCTGCCCAGGGAAGG - Intronic
930187462 2:48424604-48424626 CCCTTCCCCCATCCCAGAGCCGG - Intergenic
931430991 2:62208941-62208963 CCACTGCCCCCACCCAGGTTGGG - Intronic
931565665 2:63613463-63613485 CTCCACCCCCATCCCATGATTGG - Intronic
931682590 2:64764061-64764083 CCCCTTCCACATCCTAGATTTGG - Intergenic
931763561 2:65436091-65436113 GCCCTCCCCCCTCCCAGGGGCGG + Intergenic
932759943 2:74432666-74432688 CCCTTCCCCCAACCCTGGCTAGG - Exonic
933671700 2:85013837-85013859 CCCCTCCCCCACCCCTGCCTAGG - Intronic
934612907 2:95753953-95753975 CCCTGCCCCCAGCCCAGGCTTGG + Intergenic
934657084 2:96122053-96122075 CCCCTCCCACCACCCAGGCTGGG + Intergenic
934746941 2:96765510-96765532 ACCCTCCTCCACCCCAGGTTGGG + Intronic
934747987 2:96772116-96772138 TCCCTCCCCTACCCCAGGTAGGG + Intronic
935640907 2:105289120-105289142 CCCTTCCCCATTCCCATGTTTGG - Intronic
936029371 2:109059090-109059112 CCCCTTCCCCACCCCCGCTTTGG - Intergenic
936092565 2:109510708-109510730 GCCCTTCCCCAGCCCAGGCTGGG - Intergenic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
937275789 2:120683281-120683303 CTCCTTCCCCATCCCACGCTAGG + Intergenic
937954939 2:127416837-127416859 CCCCAACCCCACCCCAGGTTGGG - Intergenic
937974488 2:127574067-127574089 GGCCTCCCCCTTCCCAGGTCGGG + Intronic
938533886 2:132221350-132221372 CCCCTCCCCCCTCCCGGACTGGG - Intronic
938788577 2:134656361-134656383 CCCCTCGCGCTTCCCAGGTGAGG + Intronic
939895432 2:147785507-147785529 CCCCTTCCCCACTCCAGGATAGG - Intergenic
940580202 2:155570383-155570405 CCCCTCCCCCACCCCATGACAGG + Intergenic
940729036 2:157368727-157368749 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
941477971 2:165971673-165971695 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
941905995 2:170716463-170716485 CCGCCCCCGCATCCCAGCTTGGG + Exonic
942426168 2:175863138-175863160 CCCCTCTCCCATCCTGGGTCTGG + Intergenic
943119066 2:183711084-183711106 CCCCTCTCCCATCCCAGCAGAGG - Intergenic
943377574 2:187098858-187098880 CCCCTCCCCCACCCCACGACAGG + Intergenic
943639205 2:190340761-190340783 CCCCTCCCCCCACCCTTGTTAGG - Intronic
944242605 2:197500284-197500306 CCCCTCGCCCCTCCCAGGGAGGG - Exonic
944399363 2:199307734-199307756 TCCCTCCCCCCTCACATGTTTGG - Intronic
944600679 2:201300130-201300152 CCCCTCGCGCTTCCCAGGTGAGG - Intronic
945311823 2:208322843-208322865 CCCCTCCCCCACCCCATGACAGG + Intronic
945602718 2:211888727-211888749 CCCCTCGCGCTTCCCAGGTGAGG - Intronic
945733845 2:213573051-213573073 CCCCTCGCGCTTCCCAGGTGAGG + Intronic
946138926 2:217671525-217671547 CCCCACCCCCATCCCAGTGCAGG + Intronic
946239574 2:218345380-218345402 CCCTTCCCCCATCCATGGTTGGG + Exonic
946545859 2:220742386-220742408 CCCCTCGCGCTTCCCAGGTGAGG + Intergenic
946591799 2:221257667-221257689 CCCCTCCCCCACCCCACAATAGG - Intergenic
946619555 2:221546169-221546191 CCCCTCCCCCATCCCCATATAGG - Intronic
946751375 2:222896932-222896954 CCCCTCCCCCCTCCCGGACTGGG + Intronic
947096435 2:226572364-226572386 CCCCACCCCCATCTCTGGCTGGG + Intergenic
947426773 2:229990945-229990967 CCCCTCCCCCGCCCCGAGTTGGG + Intronic
947456242 2:230256516-230256538 CCCCTCCCCCACCCCACAATAGG - Intronic
947787722 2:232838812-232838834 CCCCTCCCCCACCCCAGGGCAGG + Intronic
947865626 2:233396593-233396615 CCCCTCCCCAAGGCCAGGTGGGG - Intronic
947982998 2:234425975-234425997 CCCTACCCTCCTCCCAGGTTTGG + Intergenic
948079325 2:235192618-235192640 TCCCTCCCCCACCCCACGATAGG + Intergenic
948092672 2:235307836-235307858 CCCCTCCCCCACCCCAAGACAGG - Intergenic
948258902 2:236588788-236588810 CCCCTCTCCCCTTCCAGGCTGGG - Intergenic
948384451 2:237572926-237572948 CCCCTCCCCCATCCCCTGCCAGG + Intergenic
948541024 2:238691524-238691546 TCCCTCCTCCATCCCAGGCATGG + Intergenic
948668848 2:239553573-239553595 CCCCGCCCCCATGGCAGGTGGGG + Intergenic
948945009 2:241215016-241215038 CCCCTCCCCCTCCCCAGGCAAGG - Intronic
1168816553 20:741644-741666 CCCCTCCCAAATCTCAGGTGGGG + Intergenic
1168963281 20:1883276-1883298 ACCCACCCCCACCCCAGGCTAGG + Intergenic
1169131515 20:3168334-3168356 CCCCTCCCCCCTCCCACCTGTGG - Intronic
1169265749 20:4166543-4166565 CCCCTCCTCCACCCCCAGTTAGG + Intronic
1172006258 20:31820555-31820577 CCCCTCCCCACTCCCAGGAGGGG - Intronic
1172208370 20:33180717-33180739 CCTGGCCCCCATCCCAGGCTAGG + Intronic
1172617321 20:36297945-36297967 CCTCTCCCCCATCCCCACTTTGG + Intergenic
1173177742 20:40777325-40777347 CCCCTCCTCCGTCCCAGGCCAGG - Intergenic
1173564159 20:44027441-44027463 CCACTGCCCCATCCCAGCTTAGG + Intronic
1173771834 20:45666365-45666387 CCCCTTGCCCTTCCCAGGTGAGG + Intronic
1174459523 20:50672782-50672804 CCCACCCACCACCCCAGGTTTGG + Intronic
1174660705 20:52210487-52210509 CCCCTGCCCCGTCCCCGTTTCGG - Intergenic
1175410084 20:58762059-58762081 CTCCACCCCCATCCCAGCTCAGG - Intergenic
1176417113 21:6482825-6482847 CCACTCCCCCACCCCAGTGTGGG - Intergenic
1179360924 21:40708088-40708110 CCCCTACCCCATCCTAGGGGAGG - Intronic
1179602834 21:42492138-42492160 CCGGTCCCCCTGCCCAGGTTTGG + Intronic
1179692611 21:43091158-43091180 CCACTCCCCCACCCCAGTGTGGG - Intergenic
1179921161 21:44508424-44508446 CGCCTGCTCCATCCCAGGATGGG + Intronic
1179938195 21:44618584-44618606 CCCATCCCCCATCCCCAGCTGGG + Intronic
1180428352 22:15220454-15220476 CCCCTTGCGCTTCCCAGGTTAGG + Intergenic
1180564153 22:16649014-16649036 CCCCTCCCCCATGCCACACTGGG - Intergenic
1181956349 22:26590112-26590134 CACCTCCCCCTTCCCCGGCTGGG - Exonic
1181986123 22:26800876-26800898 CCCCTCCTCCCTCCCATCTTAGG - Intergenic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1182494099 22:30694478-30694500 CCCCTCCCCCAACCCAGGCTGGG - Intronic
1182822854 22:33233612-33233634 CCTCTCCCCCATCCCTTGTCTGG - Intronic
1183059734 22:35328705-35328727 CCCCTGCCCCCTCCAAGGTCAGG - Intronic
1183343548 22:37294884-37294906 CCCCGGCCCCATCCCGGGTCTGG + Intronic
1183358217 22:37370561-37370583 CCCCTCCTCCATGCCAGGGAGGG - Exonic
1183732924 22:39628519-39628541 CACTTCCCCCATCCCAGGAGAGG - Intronic
1184158712 22:42685604-42685626 CCCCTCCCCACTCCCTGGTCTGG + Intergenic
1184614481 22:45628870-45628892 CCCCTACCCCGTGCCAGGCTGGG - Intergenic
1184729201 22:46363848-46363870 CCCCTCCCCCATCCCCGCCTGGG + Intronic
1185147585 22:49147674-49147696 CTCCTCCCCACTGCCAGGTTGGG - Intergenic
950042841 3:9931251-9931273 CCCCTCACCCCACCCAGGTCAGG - Intronic
950565674 3:13768298-13768320 CCCCTCCCCCAGCCCAGCTGGGG - Intergenic
951729050 3:25790446-25790468 CCCTTCCCCCATCGCAAGCTTGG + Intronic
952328274 3:32340333-32340355 CTCCACTCTCATCCCAGGTTCGG - Intronic
953284963 3:41597472-41597494 CGCATAGCCCATCCCAGGTTGGG + Intronic
953480011 3:43243268-43243290 CCCCTCCCCCATTACAGGGTGGG + Intergenic
954103919 3:48398920-48398942 CCCCTCCCCCAGCTCCGGATGGG + Intronic
954349552 3:50031574-50031596 CCCCTCCCCCACCCCACGACAGG - Intronic
954372693 3:50176989-50177011 CCTCTCCCCCTTGCCAGGTGGGG - Intronic
954377941 3:50204827-50204849 CCCCCACCCCACCCCTGGTTGGG + Intergenic
954460806 3:50625898-50625920 CCCCACCCCCACCCCAGGGGAGG + Intronic
954594586 3:51813953-51813975 CCCCTCCCCGATCCCATGCCTGG - Intergenic
954646399 3:52134186-52134208 CCCCTTCCCCATCCCAGCCCTGG - Intronic
955755676 3:62222957-62222979 CCCAACCCCTATTCCAGGTTGGG - Intronic
955803556 3:62710267-62710289 CCCCTCCCCCACCCCAGTTGAGG - Intronic
955961238 3:64343253-64343275 CCCCTCCACCACCCCAGGCTTGG + Intronic
958682751 3:97352831-97352853 CCCCTTCCCCATCCCAAGGCAGG + Intronic
958846345 3:99269540-99269562 CCACTCTCCCATCCCAGCTCTGG - Intergenic
961643470 3:128379801-128379823 CCCCTCCCTCACCCCAGATGAGG + Intronic
962035574 3:131648007-131648029 TTTCTCCCCCATCCCAGGATAGG + Intronic
962665972 3:137654082-137654104 CCCCTTCCACTTCCCAGGTGAGG - Intergenic
963216924 3:142758823-142758845 CCCCTCCCCCACCCCACAATAGG + Intronic
963930921 3:151003656-151003678 CCCCAAGACCATCCCAGGTTTGG - Intergenic
964500784 3:157346022-157346044 CCCCTCCCCCACCCCACGACAGG - Intronic
966783941 3:183608325-183608347 CCCCTCCCCCCTCCCGGACTGGG - Intergenic
967748476 3:193086463-193086485 CCCCTCCCCCACCCCATGACAGG + Intergenic
968831229 4:2933907-2933929 CCCCCTCCCCATCCCATGGTGGG + Exonic
969327183 4:6450784-6450806 CCCCACCCCCTACCCAGGTATGG - Intronic
969518812 4:7663991-7664013 ACCCGCCCCCATCCCTGCTTAGG + Intronic
970095769 4:12461490-12461512 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
970183373 4:13422743-13422765 CCCGTCCCCCATCCCATGACAGG - Intronic
970262481 4:14242696-14242718 CTTCTCCTCCATCCCAGTTTCGG - Intergenic
970262664 4:14244714-14244736 CTTCTCCTCCATCCCAGTTTTGG + Intergenic
971405378 4:26317799-26317821 GCCCTCCCCCATCTCAGGAAAGG - Intronic
971437214 4:26640607-26640629 CCCCTTGCCCTTCCCAGGTGAGG - Intronic
972436995 4:39044652-39044674 CCCCACCCCCTTCCCCGGCTCGG + Intergenic
972587194 4:40448905-40448927 CCCCTCCTTCACCCCAAGTTTGG - Intronic
974011154 4:56608620-56608642 CCCCTCAGCCACCCCAGGTATGG + Intergenic
974371672 4:61023993-61024015 CCTCTCCCCCATCCCACGACTGG - Intergenic
975256118 4:72236804-72236826 CCCCTTTCCCTTCCCAGGTGAGG + Intergenic
977354937 4:95933490-95933512 CCCCTCCCCCATCCCCATTTTGG - Intergenic
981173001 4:141646448-141646470 CCCCTTCCCCATACCTGCTTTGG + Intronic
982497638 4:156110631-156110653 CCCCTCCTCCATCTGAGGTGAGG - Intergenic
982525052 4:156467383-156467405 CCCCTCCCCCACCCGAGGGCAGG + Intergenic
982889106 4:160824055-160824077 CCCCTCCCCCACCCCATGACAGG - Intergenic
983561660 4:169107553-169107575 CCCAACTCACATCCCAGGTTTGG + Intronic
984587328 4:181579036-181579058 CCCCTCTCCCATCCCTGCCTGGG + Intergenic
984665239 4:182419863-182419885 CCCCTCCCCCACCCCACGACAGG - Intronic
984804015 4:183736466-183736488 CCCCTCCCCCCTCCCGGATGGGG + Intergenic
985657316 5:1139055-1139077 CCCCCCCCCCACCCCAAGCTTGG - Intergenic
985794681 5:1953200-1953222 CTCCTCTCCCACCCCAGGTTGGG - Intergenic
985848189 5:2369767-2369789 CGCCTCCCCCATGCCAGGCAAGG + Intergenic
986101459 5:4615617-4615639 CCCCTCGCGCTTCCCAGGTGAGG - Intergenic
986255206 5:6096641-6096663 TCCCTCCCCCCTCCCCTGTTGGG - Intergenic
986958896 5:13189916-13189938 CCCCCTTCCCATCCCAGGTAAGG + Intergenic
987087939 5:14487367-14487389 CCCATGACCCATCCCAGGGTGGG + Intronic
987128492 5:14838106-14838128 CCCTTCCCCCACCCCACGTCAGG - Intronic
987678587 5:21107603-21107625 CCCCTCGCGCTTCCCAGGTGAGG - Intergenic
988152287 5:27399803-27399825 CCCTCCCCCCATCCCAGGACAGG - Intergenic
988309767 5:29542107-29542129 CCCCTCACCCTTCCCAGGTGAGG + Intergenic
988950574 5:36254976-36254998 CCCGACCCCCATCCCATGTCTGG + Intronic
989418204 5:41205427-41205449 CCCCTTGCACATCCCAGGTGAGG - Intronic
989543507 5:42645686-42645708 CTGCTCCACCATCCCAGGTCAGG + Intronic
989587915 5:43088130-43088152 CCCCTCCCCCCTCCCGGACTGGG + Intronic
990038213 5:51348858-51348880 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
990071784 5:51791084-51791106 CCCCTTGCCCTTCCCAGGTGAGG + Intergenic
992863672 5:80937195-80937217 CTCTTCCCCCATCTCAGCTTTGG + Intergenic
994861718 5:105203793-105203815 CCCCTCCCCCAACCCACGACAGG - Intergenic
995127299 5:108590849-108590871 ACCCTCCTCAACCCCAGGTTAGG - Intergenic
995670564 5:114598184-114598206 CCCCTCCCCCCCCCCCGCTTTGG - Intergenic
996152619 5:120058318-120058340 CCCATCCCCCACCCCAGGTGTGG - Intergenic
996152642 5:120058459-120058481 CCCATCCCCCAGCCCAGGCGTGG - Intergenic
996547368 5:124694718-124694740 CCCCTCCCCCACCCCATGACAGG + Intronic
997265932 5:132495616-132495638 CCCCTCCCCTCTCAAAGGTTTGG + Intergenic
997457161 5:134025988-134026010 TCCCTCCCCCAGGCCAGGCTCGG - Intergenic
999244065 5:150144132-150144154 CCCCTCCTCCAGCACAGGCTCGG + Intronic
999453946 5:151699270-151699292 TCCCAGCCCCATCCCAAGTTAGG + Intergenic
1000560933 5:162788617-162788639 CCCCTTCCCCATCCCCGCATAGG + Intergenic
1000860499 5:166450793-166450815 CCCCTCGCACTTCCCAGGTGAGG + Intergenic
1001422183 5:171596408-171596430 TGCCTCCCCCATCCCTGGATGGG - Intergenic
1001617779 5:173056683-173056705 CCCCTCCCCCACCCCCGGCCCGG + Intronic
1001965617 5:175908010-175908032 CCCCTCACCCATCTCAGGCTTGG + Intergenic
1001983315 5:176051949-176051971 CCCCTCCCGCTTCCCAGGCGAGG - Intronic
1002065151 5:176648038-176648060 CGCATCCCACATCCCAGGGTAGG - Intronic
1002099759 5:176851590-176851612 CCCCGCCCCCAGCCCAGGTGTGG - Intronic
1002137166 5:177114894-177114916 TCCCTCCCCCATCCCAGCCAAGG + Intergenic
1002234150 5:177792103-177792125 CCCCTCCCGCTTCCCAGGCGAGG + Intronic
1002251332 5:177931185-177931207 CCCCTCACCCATCTCAGGCTTGG - Intergenic
1002460208 5:179369556-179369578 CCCCTCCCCCAGCCCAGGAACGG - Intergenic
1002526998 5:179820571-179820593 CCCCTCGCCCCTCCCAGGCTTGG - Intronic
1003318210 6:5030345-5030367 CACCTTCCCCACCCCAGGCTGGG + Intergenic
1003324833 6:5084298-5084320 CCCCTCCCCGGCCTCAGGTTCGG + Intergenic
1005050938 6:21683390-21683412 TCCTTCCCACATCCCAGGATTGG + Intergenic
1005222072 6:23598227-23598249 CCCCTCCCCCACCCCAGGACAGG - Intergenic
1005587285 6:27288946-27288968 CCCCTCCCCCATCCGGTGCTGGG - Intronic
1005832961 6:29685685-29685707 CCTCTCCCCCATCCTAGGGATGG + Intergenic
1006215650 6:32440282-32440304 CCCCACCCCCACCCCCAGTTTGG - Intronic
1006379119 6:33687578-33687600 CCCCACCCCCACCCCAGTCTCGG - Intronic
1006502370 6:34466749-34466771 CCCCGCTCCCATCCCAGCTGTGG - Intronic
1006582258 6:35083853-35083875 CCCCTCCCACCTTCCAGGGTGGG - Intronic
1007345803 6:41228638-41228660 AACCTCCCCCATCACAGGCTGGG - Intronic
1007390691 6:41548056-41548078 TCCCACCCCGATCCTAGGTTGGG + Intronic
1007759690 6:44126947-44126969 CCCCTCCCCTTTCCCAACTTAGG - Exonic
1007872954 6:45062639-45062661 CCCCTCGCGCTTCCCAGGTGAGG - Intronic
1007881791 6:45176253-45176275 CCCCTCGCGCTTCCCAGGTGAGG - Intronic
1008063968 6:47027864-47027886 CCTCTCCACCATCCCTGGCTTGG - Intronic
1008078814 6:47173532-47173554 CCCCTCCCCCATCCCACAACAGG - Intergenic
1008786122 6:55170730-55170752 CCCCTCCCCCACCCCACGACAGG + Intronic
1010251100 6:73708146-73708168 CCCTTCCCCCATCCCACGACAGG + Intronic
1011304242 6:85908971-85908993 CCCCTCGCACTTCCCAGGTGAGG + Intergenic
1011334695 6:86247316-86247338 CCCTTCCTCCATGCCTGGTTAGG + Intergenic
1011895214 6:92216888-92216910 CCACCCCCCCATCACAGGCTTGG + Intergenic
1012148733 6:95718753-95718775 GCCCTCCCCCATAACAGGTCTGG - Intergenic
1012251986 6:96990746-96990768 CCCCGCCCCCACCCCAGCTTGGG - Intronic
1016558649 6:145369374-145369396 TCCCTACCCCATCCCAGATAGGG + Intergenic
1018114713 6:160572140-160572162 CCCCTTCCACTTCCCAGGTGAGG + Intronic
1018488076 6:164262746-164262768 CCCCTCCCCCACTCCACATTGGG + Intergenic
1018858876 6:167696345-167696367 GCCCTCCCCCATCAGAGGATGGG - Intergenic
1019525975 7:1480747-1480769 CCCGTCCCCCTCCCCAGGCTGGG + Intronic
1019562765 7:1666443-1666465 CCCATCCACCCACCCAGGTTCGG + Intergenic
1019953998 7:4398663-4398685 CCCCTCCCCAATCCGTGGTGTGG + Intergenic
1020122305 7:5511829-5511851 CCCTGCGCCCAGCCCAGGTTAGG - Intronic
1020228180 7:6296560-6296582 CACCACCCCCAGCCCAGGCTAGG - Intergenic
1020693967 7:11392270-11392292 CCCCTCGCACTTCCCAGGTGAGG - Intronic
1021031860 7:15747067-15747089 CCCCTCCCCATTCCCAGCTCAGG - Intergenic
1021094953 7:16525944-16525966 CCCCACCTTCATCCCAGGTGTGG + Intronic
1021189351 7:17602444-17602466 GCTCTCCCCCATCACAGGTGTGG + Intergenic
1022208063 7:28181440-28181462 CCACTCCACCATCTCAGGTCTGG + Intergenic
1022452381 7:30526486-30526508 CCCCTCCCCTCTCCCAGAGTGGG - Intronic
1022702032 7:32770694-32770716 CCCCACCCCCATCCTAGTTCTGG + Intergenic
1022906274 7:34860850-34860872 CCCCACTCCCATCCTAGTTTTGG + Intronic
1023598069 7:41853504-41853526 CCCTTCCCCAACCCCAGGTTGGG - Intergenic
1023840723 7:44096192-44096214 CCCCACCCCCATCAGAGTTTCGG + Intergenic
1023841016 7:44097432-44097454 CTCCTCCCCCTGCCAAGGTTAGG - Intergenic
1023909103 7:44541248-44541270 GGCCTCCGCCATCCCAGGTCTGG + Exonic
1024020271 7:45362164-45362186 CCCCTCCCCATCCCCAGGCTTGG + Intergenic
1024315226 7:48009858-48009880 CCATTCCCCCATTCCAGGTGAGG - Intronic
1024350739 7:48360187-48360209 CCCCTCCCCCACCCCATGACAGG + Intronic
1025803596 7:64809500-64809522 CCCCACCTCCCTCCCAGGATGGG + Intronic
1025959195 7:66205506-66205528 CTCCTCACTCATCCCAGGTAAGG + Exonic
1026840047 7:73665446-73665468 CCTCTCCACCTTCCCAGGCTAGG - Intergenic
1026906469 7:74065793-74065815 ACCCTCCCCCAGCCCAGCTCAGG + Intronic
1027336317 7:77154453-77154475 CCCCTCCCCCACCCCATGACAGG + Intronic
1028830507 7:95322679-95322701 CCCCTCCCCTACCCCAACTTGGG - Intronic
1029779471 7:102716648-102716670 CCCCTCCCCCACCCCATGACAGG - Intergenic
1030525941 7:110655280-110655302 CCCCTCCCCCACCCCACGACAGG + Intergenic
1032178062 7:129649307-129649329 CCCCCACCCCACCCCGGGTTTGG + Intronic
1032194315 7:129780600-129780622 CCCCTCCCCCCTCCCAGGGTCGG - Intergenic
1032938053 7:136756872-136756894 CCTTTCTCCCATCCCAGGCTTGG + Intergenic
1034136081 7:148771519-148771541 CCCCTCCCCACTCCGAGGTTCGG - Intronic
1034285330 7:149880126-149880148 CCCCTCTCTCATCCCAGCTCTGG - Exonic
1034961781 7:155367672-155367694 CCCCTCCCCCCTCCCGGACTGGG + Intronic
1035265766 7:157689723-157689745 CGCCTCCCCCACCCCAGGTGAGG - Intronic
1035657205 8:1319182-1319204 CCCCTCCCTCCTCCCTGGTCAGG + Intergenic
1036135318 8:6154944-6154966 CCCGTCCCCCAGGCTAGGTTAGG - Intergenic
1036210501 8:6836453-6836475 CCCCACCCCCATCCCCGATGTGG - Intergenic
1036217130 8:6889924-6889946 CCCCTCCCCAGTCTCAGGTAAGG + Intergenic
1036773900 8:11596934-11596956 CCGCACCCCCATCTCAGGTATGG + Intergenic
1036778825 8:11631699-11631721 CCCCCGCTCCATCCCCGGTTGGG - Intergenic
1037887532 8:22602649-22602671 CCCCGTGCCCAGCCCAGGTTAGG + Intronic
1038613624 8:29074096-29074118 CCCCGCCCCCACCCCGGGTAAGG + Intronic
1038870081 8:31484268-31484290 CCCCTCCCCCACCCCATGACAGG + Intergenic
1039843882 8:41311928-41311950 CCTCTCCCACATCCCAGGAATGG - Intergenic
1040121187 8:43687510-43687532 CCCCACCTCCCTCCCAGGTGGGG + Intergenic
1040354936 8:46608324-46608346 CCCCTTGCCCTTCCCAGGTGAGG - Intergenic
1040835253 8:51724068-51724090 CCCCACCCCCACCCCTGGTCCGG - Intronic
1040847478 8:51859054-51859076 TACCTCCCCCATCCCAAGTTTGG + Intronic
1041329941 8:56713925-56713947 CCCCTCCTCCTTCCCAGGGAAGG + Intergenic
1041363214 8:57073244-57073266 CACCTCCCCCATCTCAGGTAGGG - Intergenic
1041696854 8:60744928-60744950 CCACTCCCTCAGCCCAGCTTAGG - Intronic
1042829399 8:73009865-73009887 CCCCGCCCCCGTCCCAAGATGGG + Intronic
1042855213 8:73260380-73260402 CCCCTCCCCCACCCCACGACAGG - Intergenic
1042959859 8:74292019-74292041 CCCCTCCCCCACCCCACGACAGG - Intronic
1043316490 8:78928425-78928447 CCCCTCCCCCACCCCATGACAGG - Intergenic
1044259277 8:90098524-90098546 ACCCTCCCCCGTCGCAGGTTCGG - Intergenic
1044819692 8:96147229-96147251 CCCACACCCCATCTCAGGTTGGG - Intronic
1045357168 8:101399539-101399561 CAGCTCCCCCATCTCAGTTTGGG + Intergenic
1047262632 8:123275405-123275427 CCCCACCCCCATCCCAGTCGCGG + Intronic
1048805781 8:138239992-138240014 CCCCTCCCCCACCCCATGACAGG - Intronic
1048816467 8:138339103-138339125 CCCCTCCCCCACCCCATGACAGG - Intronic
1049203199 8:141351718-141351740 CCCCACCCCCACCCCAGGACAGG - Intergenic
1049470323 8:142772438-142772460 CACCTCCCCCTTCCCAGGCTTGG + Intronic
1049672770 8:143877228-143877250 GCCCTGCCCCTTCCCAGGCTTGG + Intronic
1051205648 9:14686048-14686070 CCCCTCCCCCACCCCACGACAGG - Intronic
1052604535 9:30682068-30682090 CCCCTCCCCCAACCCATGACAGG - Intergenic
1052806435 9:33017930-33017952 CCCCCCCCCCCTCCCATTTTCGG + Intronic
1053139462 9:35673757-35673779 CTCCACCCCCATCCTAGCTTTGG + Intronic
1053418887 9:37964337-37964359 CGCCGTCCCCATCCCAGGTTTGG - Intronic
1054870590 9:70044379-70044401 CCCCACCCCCACCCCAGGCTTGG - Intronic
1055765862 9:79663038-79663060 CCCCCACCCCCACCCAGGTTGGG - Intronic
1055920529 9:81455427-81455449 GCCCTCTCCCATCCCAGGGCAGG - Intergenic
1056963296 9:91145474-91145496 CCCCAACCCCACCCCAGCTTGGG - Intergenic
1057039408 9:91836647-91836669 CCCCTGCCCCACCCCCGGTCTGG + Intronic
1057312015 9:93948772-93948794 CCCCTCCCCCATCCCGGGCCGGG + Intergenic
1057315771 9:93967345-93967367 CCCCTCGCTTCTCCCAGGTTAGG + Intergenic
1058828218 9:108793778-108793800 CCCCTCCCCGCTCCCAGCTGGGG + Intergenic
1059142366 9:111865432-111865454 TCCTGCCCCCATCCCAGGTCAGG - Intergenic
1059405699 9:114097431-114097453 CCTCCCTCCCCTCCCAGGTTCGG - Exonic
1059429805 9:114243281-114243303 AGCCTCCCCCATCCCTGGGTTGG - Intronic
1059972189 9:119679218-119679240 CCCCTGCCCCTTCTCAGGGTGGG + Intergenic
1060182797 9:121545774-121545796 CTCCGCCTCCATCCCAGGTGTGG - Intergenic
1061212974 9:129204082-129204104 ACCCTCCCCCATTCCAGATGTGG + Intergenic
1061400504 9:130365738-130365760 CCCCTCCCCCTGCCCAGCCTGGG - Intronic
1061503028 9:131014435-131014457 CCCCTCACCCCTCTAAGGTTGGG + Intronic
1062238706 9:135524734-135524756 CCCCTTCCCCAGCCCAGCTCAGG + Intronic
1062269675 9:135702716-135702738 CCCCTGCCCCACCCCAGCTTGGG + Intronic
1062363618 9:136198815-136198837 CCCCGCCCCGCCCCCAGGTTTGG - Exonic
1062524988 9:136974609-136974631 CCCCTCCCCAGTCCCAGGCTGGG + Intergenic
1187261358 X:17687664-17687686 CCTCTTCCCCACCCCAGGGTTGG + Intronic
1188943299 X:36266065-36266087 CAGCTCCTCCATCCCAGCTTGGG - Intronic
1189623708 X:42872286-42872308 CCCCTCCCCCACCCCAAGACAGG + Intergenic
1189937465 X:46084637-46084659 CCCCTCCTCCACCCCTAGTTTGG - Intergenic
1190106575 X:47565145-47565167 CCCCCCACCCACCCCAGGCTGGG - Intronic
1190940896 X:55040288-55040310 CCCCTCCCCCACCCCACGACAGG + Intergenic
1191222275 X:58002587-58002609 CCCCTTGCACATCCCAGGTGAGG - Intergenic
1191851589 X:65589577-65589599 TTCCTCTCCCTTCCCAGGTTTGG - Intronic
1192429646 X:71103393-71103415 CCCCTCCCCCACCCCTGCTGTGG + Exonic
1192598478 X:72437214-72437236 CCCCTTCCACTTCCCAGGTGAGG - Intronic
1193019974 X:76781052-76781074 CCCCTTGCACATCCCAGGTGGGG + Intergenic
1193067285 X:77273952-77273974 CCCTACCCCCATCCCATGATAGG - Intergenic
1193130146 X:77911000-77911022 CCCCTCCTCTATCCCCTGTTAGG - Intronic
1193257469 X:79367074-79367096 CCCCTCCCCCATCCCGCCCTGGG + Intronic
1193889330 X:87024363-87024385 CCCTTCCACCATCCCACTTTTGG + Intergenic
1194190939 X:90836423-90836445 CCCCTCGCGCTTCCCAGGTGAGG - Intergenic
1194247585 X:91534936-91534958 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1194595033 X:95847426-95847448 CCCCTCCCCTACCACAGGTAGGG + Intergenic
1194608064 X:96006006-96006028 ACCCTTCCTCATCCCAAGTTTGG - Intergenic
1195342916 X:103922354-103922376 CCCCTCCCCCACCCCACGACAGG + Intronic
1195813319 X:108858288-108858310 CCCCTCCCCCATCCCACAACAGG + Intergenic
1196304214 X:114082558-114082580 CCCCTCCCCCACCCCATGATAGG + Intergenic
1196603914 X:117633884-117633906 CCCCTCCCCCACCCCATGACAGG - Intergenic
1196902517 X:120399836-120399858 CCCCTCCCCCACCCAAGGGAGGG + Intergenic
1197181075 X:123538062-123538084 CCCCTCCCCCACCCCAGATTTGG + Intergenic
1197729727 X:129799246-129799268 CCCTTCCCCCCTCCCAAGTCAGG + Intergenic
1198055858 X:132994220-132994242 CCCCACCCCAATCCAATGTTAGG + Intergenic
1198301004 X:135334253-135334275 CCATTCCCCCAGGCCAGGTTGGG + Intronic
1199600412 X:149538348-149538370 CCCCGTCCCCACCCCACGTTAGG - Intergenic
1200002529 X:153069387-153069409 CCTCTCCCCCACCCCACTTTTGG - Intergenic
1200005195 X:153080623-153080645 CCTCTCCCCCACCCCACTTTTGG + Intergenic
1200162297 X:154015794-154015816 CCCTGCCCCCAGCCCAGGTGGGG + Intronic
1200537600 Y:4418840-4418862 CCCCTCACGCTTCCCAGGTGAGG - Intergenic
1200566607 Y:4776469-4776491 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1201551921 Y:15226628-15226650 CCCCTCCCCCACCCCACTATAGG - Intergenic
1201787312 Y:17799322-17799344 ACCCTCCTCCAGCCCAGGATTGG - Intergenic
1201814241 Y:18106666-18106688 ACCCTCCTCCAGCCCAGGATTGG + Intergenic
1201992530 Y:20043220-20043242 CCCTTCCCCCATCCAAGCTCAGG + Intergenic
1202366217 Y:24167896-24167918 CCCCTCCCCTCTCCCAGATTGGG + Intergenic
1202504564 Y:25502227-25502249 CCCCTCCCCTCTCCCAGATTGGG - Intergenic