ID: 1071087281

View in Genome Browser
Species Human (GRCh38)
Location 10:81877459-81877481
Sequence CATTAACTCTTCAGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071087280_1071087281 10 Left 1071087280 10:81877426-81877448 CCATAGCATCTGAGATAAAGGAA 0: 1
1: 0
2: 1
3: 24
4: 332
Right 1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071087281 Original CRISPR CATTAACTCTTCAGTGATGA TGG Intronic
No off target data available for this crispr