ID: 1071100209

View in Genome Browser
Species Human (GRCh38)
Location 10:82028000-82028022
Sequence GGGTTGTATTATTAACTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071100201_1071100209 15 Left 1071100201 10:82027962-82027984 CCATCCACTACTCACTGCCCACT 0: 1
1: 0
2: 1
3: 25
4: 349
Right 1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG No data
1071100202_1071100209 11 Left 1071100202 10:82027966-82027988 CCACTACTCACTGCCCACTGCAC 0: 1
1: 0
2: 3
3: 38
4: 365
Right 1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG No data
1071100204_1071100209 -2 Left 1071100204 10:82027979-82028001 CCCACTGCACTCTTTTTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG No data
1071100206_1071100209 -3 Left 1071100206 10:82027980-82028002 CCACTGCACTCTTTTTGGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 237
Right 1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG No data
1071100200_1071100209 16 Left 1071100200 10:82027961-82027983 CCCATCCACTACTCACTGCCCAC 0: 1
1: 0
2: 1
3: 17
4: 234
Right 1071100209 10:82028000-82028022 GGGTTGTATTATTAACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071100209 Original CRISPR GGGTTGTATTATTAACTGCT GGG Intronic
No off target data available for this crispr