ID: 1071100978

View in Genome Browser
Species Human (GRCh38)
Location 10:82037318-82037340
Sequence CATTCTGCCCTGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071100978_1071100982 2 Left 1071100978 10:82037318-82037340 CCCAGCTCCATCAGGGCAGAATG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1071100982 10:82037343-82037365 GAGCTCAGCAGTTTGAAGTCTGG No data
1071100978_1071100984 18 Left 1071100978 10:82037318-82037340 CCCAGCTCCATCAGGGCAGAATG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1071100984 10:82037359-82037381 AGTCTGGTCTCCATGGCACTAGG No data
1071100978_1071100985 19 Left 1071100978 10:82037318-82037340 CCCAGCTCCATCAGGGCAGAATG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1071100985 10:82037360-82037382 GTCTGGTCTCCATGGCACTAGGG No data
1071100978_1071100983 11 Left 1071100978 10:82037318-82037340 CCCAGCTCCATCAGGGCAGAATG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1071100983 10:82037352-82037374 AGTTTGAAGTCTGGTCTCCATGG No data
1071100978_1071100986 26 Left 1071100978 10:82037318-82037340 CCCAGCTCCATCAGGGCAGAATG 0: 1
1: 0
2: 3
3: 20
4: 195
Right 1071100986 10:82037367-82037389 CTCCATGGCACTAGGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071100978 Original CRISPR CATTCTGCCCTGATGGAGCT GGG (reversed) Intronic
902201170 1:14834773-14834795 ATTCCTACCCTGATGGAGCTTGG + Intronic
904417126 1:30369990-30370012 AACTCTACCCTCATGGAGCTGGG + Intergenic
904866204 1:33580882-33580904 GACTCTGTCCTGATGGACCTGGG + Exonic
905474494 1:38216545-38216567 CATTCTGCCCTGAAGGAGAGCGG + Intergenic
905899610 1:41572570-41572592 CATCCTGCCCTCAAGGTGCTTGG - Intronic
907238368 1:53066924-53066946 CCTTCTGCCCTGATTGAATTTGG + Intronic
908122480 1:60999344-60999366 GAGTCTGCCCTGGTGGAACTAGG + Intronic
908249105 1:62251217-62251239 CACACTGCCCTGTGGGAGCTGGG + Intronic
913187279 1:116380417-116380439 CATCCTGCCCTGTTGGAGGCTGG + Intronic
913258894 1:116980874-116980896 AAGTCTGTCCTCATGGAGCTTGG + Intronic
913955526 1:143287806-143287828 GAATCTGCCCTGATGCAGCCAGG + Intergenic
913981906 1:143527635-143527657 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914076269 1:144354290-144354312 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914102909 1:144612206-144612228 GAATCTGCCCTGATGCAGCCAGG + Intergenic
915242489 1:154533174-154533196 ACTTCTGCCCTCATGGGGCTGGG - Intronic
917668150 1:177245809-177245831 CACACTGCCCTGGTGGGGCTTGG - Intronic
919057394 1:192588177-192588199 CATTCTTCCCACATGGAGTTAGG + Intergenic
922605119 1:226885401-226885423 CATGCTGCCCTGATGGAGTGCGG - Intronic
923559565 1:235028237-235028259 GATTCTGCCGTGATGGTTCTGGG + Intergenic
1063815511 10:9767235-9767257 CAATGTGACCTGATGGAGGTGGG + Intergenic
1067066318 10:43106026-43106048 CACTCTCCCCTGAGGAAGCTGGG - Intronic
1069753081 10:70757297-70757319 TCTTCTTCCCTGATGGAGCAGGG - Intronic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1071161165 10:82746489-82746511 CATTGTGCCCTGGGAGAGCTGGG + Intronic
1073188478 10:101632245-101632267 CATCCTGCCCTGATGCACTTGGG - Intronic
1073591671 10:104763589-104763611 TGTTCTGCCCTGATGGAGAGTGG - Intronic
1075410067 10:122221034-122221056 CATTCTGCTCCTATGGACCTAGG - Intronic
1076728986 10:132429063-132429085 AAGCCTGGCCTGATGGAGCTGGG - Intergenic
1077155576 11:1089455-1089477 CGTGCTGCCCTCATGGAGCCAGG - Intergenic
1079495447 11:21038149-21038171 CTTTGTGCCCTGATGCAGCTGGG - Intronic
1082872243 11:57953929-57953951 CCTTCTGCGCTGATGTTGCTGGG + Intergenic
1085620800 11:78036758-78036780 CTGGCTGCCCTCATGGAGCTTGG - Intronic
1085743163 11:79094068-79094090 CCTTCCGCCATGATGGAGATGGG - Intronic
1086937375 11:92759593-92759615 CCTTATGGCCTGAGGGAGCTGGG + Intronic
1088271670 11:108040804-108040826 CATTCTTCCCTGATACAGCAAGG + Intronic
1088348020 11:108852236-108852258 CATTCTACCTTAATAGAGCTTGG - Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1089451693 11:118602602-118602624 AATTCTTCCCTGATGCAGTTAGG - Exonic
1089697480 11:120225070-120225092 CCTTCCGGCCTGAGGGAGCTAGG - Intronic
1090227988 11:125083028-125083050 CCCTCAGCCCTGGTGGAGCTTGG - Intronic
1091368195 11:135039016-135039038 CATTGTGGCCTGAAGGACCTGGG - Intergenic
1091712058 12:2749182-2749204 CCTTCTGCCTTGATGTCGCTGGG - Intergenic
1093209870 12:16295491-16295513 AATTGTGCCCTGAAGGAGTTTGG + Intergenic
1101064390 12:101004331-101004353 GATTCTGCCCTTGTGGTGCTGGG + Intronic
1101450223 12:104769480-104769502 TATTCTTTCCTGATGGAGCAGGG - Intergenic
1101451506 12:104783648-104783670 CATTTTGCACTCATTGAGCTTGG - Intergenic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1113813638 13:113157320-113157342 CCCTCTGCCCTCCTGGAGCTTGG + Intergenic
1113937869 13:114004589-114004611 CATTCTGCCCGGCGTGAGCTGGG - Intronic
1119018581 14:71085238-71085260 CTTTCTGCCTTGATGTTGCTGGG + Intronic
1120624030 14:86802530-86802552 CATTCAGCCCTGCAGGAGTTGGG - Intergenic
1122027165 14:98886453-98886475 CTCTCTGCCCTCCTGGAGCTTGG + Intergenic
1123955649 15:25331594-25331616 GTCTCTGCCCTCATGGAGCTTGG + Intergenic
1124361465 15:29039533-29039555 AATTCTGACCTCATGGAGCTGGG + Intronic
1124876614 15:33600921-33600943 CACCCAGCCCTGATGGTGCTTGG - Intronic
1124896740 15:33784580-33784602 CATCCGGCACTGAAGGAGCTAGG - Intronic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1126492507 15:49253921-49253943 CATTCAGCCCTTCTGGATCTTGG + Intronic
1126809997 15:52392788-52392810 GATGTTGCCCTCATGGAGCTTGG + Intronic
1128230731 15:66033308-66033330 CATTCTGCCCTCCTAGAGCTCGG - Intronic
1128253372 15:66179419-66179441 CATTCCGCCCAGCTGGAGGTTGG + Intronic
1128666291 15:69540529-69540551 CATTCAGCACTGGTGTAGCTGGG + Intergenic
1129524385 15:76204590-76204612 CACTCTACCCTGCTGAAGCTGGG - Exonic
1129776171 15:78237811-78237833 ACTTCTGACCTGAAGGAGCTGGG - Intronic
1131330700 15:91496457-91496479 CATTCTTCCCATATAGAGCTAGG - Intergenic
1132058449 15:98670259-98670281 CATTTTGCCCAGAGGGATCTTGG + Intronic
1132587129 16:710483-710505 CCATCTGCCCTGAGGGAGTTGGG - Intronic
1133103374 16:3492500-3492522 CATCCTGCCCAGAGGGACCTGGG + Intergenic
1134840970 16:17401267-17401289 CATTCTGCCTTGAGGTTGCTGGG + Intronic
1134890085 16:17833594-17833616 GACTCTGGCCTCATGGAGCTTGG - Intergenic
1137718965 16:50616469-50616491 CCTTCTGCCTTGATGGAGACTGG - Intronic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1141331255 16:83113525-83113547 GAGTCTGCCCTTACGGAGCTGGG + Intronic
1141808225 16:86356265-86356287 CATTCTGTCCTTGTGGTGCTGGG + Intergenic
1143323522 17:6083353-6083375 CACTGTGCCCTGGAGGAGCTCGG + Intronic
1144745321 17:17610060-17610082 CATTCTGCCTTTATGGTGTTTGG + Intergenic
1147359441 17:39921864-39921886 CATCCTGGCCTGGTGGAGGTTGG - Intronic
1147817155 17:43218297-43218319 CAGCCAGCCCTGATGGAGCTGGG - Exonic
1148232273 17:45943949-45943971 ACTTCTGCCCTGATGGTGGTGGG - Intronic
1149673466 17:58436274-58436296 GATTCTGCTCTGATAGACCTTGG - Intronic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1151768332 17:76143618-76143640 CATCCTGCCCTGATGGAGAGGGG - Exonic
1152162177 17:78675582-78675604 CATTCTGCCCTGGCTGCGCTGGG - Exonic
1152966695 18:122640-122662 CACTCTGCCCACATGGGGCTTGG + Intergenic
1153274888 18:3358720-3358742 CATTTTGCCCTGATAGAACCAGG - Intergenic
1156950960 18:42897274-42897296 GATTCTGATCTGATGGCGCTGGG + Intronic
1157680821 18:49604307-49604329 AATTCTGCCTTCATGGAGTTTGG - Intergenic
1158006698 18:52680585-52680607 CTCTCTTCCTTGATGGAGCTGGG - Intronic
1159422961 18:68247161-68247183 CATTATACCCTGAGGGTGCTGGG - Intergenic
1161463699 19:4415133-4415155 CATTCTACCCAGCTGGAGCCCGG - Intronic
1162017857 19:7855411-7855433 CATTCTGTGCTGATGGATTTTGG - Intronic
1162709860 19:12584768-12584790 CATGTTGCCCTGAAGGATCTCGG + Intronic
1166585345 19:43941700-43941722 TATTCTGCCCTCAAGGAGATGGG - Intergenic
1167880552 19:52453930-52453952 CCTTCTGGCCTCTTGGAGCTCGG + Intronic
926043118 2:9690586-9690608 CATGCTGGCCAGAAGGAGCTGGG + Intergenic
927512089 2:23650144-23650166 AAGTCTGCCCTGGGGGAGCTGGG + Intronic
930386834 2:50707584-50707606 CCTGCTGCCCTGATGAAGCCTGG + Intronic
931778215 2:65557752-65557774 CATTCTGAGCTGCTGGAGGTAGG + Intergenic
932912726 2:75821738-75821760 CATTCTTGCCAGATGGGGCTTGG + Intergenic
936664651 2:114580225-114580247 CATTCGGTCCTGATAGGGCTTGG + Intronic
937653506 2:124347443-124347465 CCTTCTGCCCTGGTGGAGGAGGG - Intronic
938255982 2:129860305-129860327 CATTCTGCTCTGATGTCCCTGGG - Intergenic
940757240 2:157697556-157697578 CACTCTTCCTTGATGGAGCTGGG + Intergenic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
942127862 2:172845542-172845564 CATCCTGACATGATGTAGCTGGG + Intronic
945060839 2:205907297-205907319 AATTCTGCTTTGCTGGAGCTGGG + Intergenic
946547221 2:220757459-220757481 CATTTTGACATGATGGAGATAGG + Intergenic
1169088510 20:2841739-2841761 CTTTCAGCCCTGAAGGAGCCTGG - Intronic
1169244007 20:4010793-4010815 GATGCTGGCCTGATGGCGCTGGG + Intronic
1170748284 20:19120378-19120400 GATTCTGTCCTGGTGGGGCTGGG + Intergenic
1171174292 20:23039894-23039916 GCTTCTGCCTTCATGGAGCTTGG + Intergenic
1173859067 20:46270226-46270248 CATTCTGACCTGATGGTGCTGGG + Intronic
1176150981 20:63590528-63590550 CAGTCTGCCCAGCTGGCGCTTGG - Exonic
1178334226 21:31730172-31730194 CTTCCTGCCCTCATGGAGCCAGG + Intronic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1180181760 21:46121311-46121333 CATCCTGCCCTGAAGGACCCAGG + Intronic
1180883978 22:19226596-19226618 CATTCTCCCATGTTGCAGCTGGG + Intronic
1182975042 22:34615827-34615849 CATTGTGCCATGACGTAGCTAGG - Intergenic
1184037373 22:41925194-41925216 CATTCAGCCCCCATGGAGTTTGG - Exonic
1184188469 22:42879536-42879558 CATGCTGGCCTGAGGGGGCTGGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949119959 3:373466-373488 CTTTCTCCCCTGCTGGAGCCAGG - Intronic
950297945 3:11848115-11848137 CCTGCTGCCCTGCAGGAGCTAGG + Intergenic
955982314 3:64539507-64539529 CATTCGGGGCTGATGAAGCTCGG - Intronic
956865458 3:73364573-73364595 CTTTCTGCCCTGATGGCCTTTGG + Intergenic
957418539 3:79937731-79937753 CATTCTTCCATGAAAGAGCTTGG + Intergenic
959418386 3:106104396-106104418 GATTTTCCCCTGGTGGAGCTGGG - Intergenic
960522029 3:118666033-118666055 CATATTGCCCTGTTGGAGCTTGG - Intergenic
960532382 3:118779734-118779756 CATTCTGCCTTGGTGGGTCTTGG - Intergenic
961814609 3:129543099-129543121 CAATCAGCCCTGATTGGGCTGGG - Intergenic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
968037619 3:195561408-195561430 AAATCTGCCATGATGGAGATGGG - Intergenic
968984985 4:3870145-3870167 CATTCTGCTCTGGGAGAGCTGGG - Intergenic
969180316 4:5435736-5435758 CTCTCTGCCCTCAAGGAGCTTGG + Intronic
970565012 4:17323468-17323490 CATTTTGCTGTGATGGAGCAGGG - Intergenic
973879092 4:55250692-55250714 ACTTCTGTCCTCATGGAGCTGGG - Intergenic
975489828 4:74976253-74976275 CATTCTCCCCTGCTGGTGCCAGG + Intronic
978108269 4:104930846-104930868 CAATCTGGCATGCTGGAGCTTGG + Intergenic
981862323 4:149371517-149371539 CCTTCTGGCATGATGGAGCTTGG - Intergenic
988524432 5:31974688-31974710 CATACTGCCCTGAAGGAACTGGG - Intronic
992796205 5:80256603-80256625 TGTTCTGCCCTGATGGCACTTGG + Intergenic
993013625 5:82511194-82511216 CATTTTGCCCTGAGGGAGACTGG + Intergenic
993434959 5:87881606-87881628 CAATCTGCGCTCATGGAGCCTGG + Intergenic
995481763 5:112600400-112600422 CTTTCTGGCCTGATGGGGATGGG - Intergenic
995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG + Intergenic
999380677 5:151119044-151119066 CATTCTGGCCTGCTGGAGAGAGG - Intronic
1001010484 5:168093266-168093288 CACCCTGGCCTGTTGGAGCTGGG + Intronic
1001561005 5:172668895-172668917 CATTCTGCTCTGAAGGACCTGGG - Intronic
1003405118 6:5821482-5821504 CCCTCTGCCCAGGTGGAGCTTGG + Intergenic
1003487178 6:6589831-6589853 CATCATGCCCTGCTGGAGATAGG - Intronic
1005857504 6:29873670-29873692 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1005863299 6:29917776-29917798 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1005874840 6:30003026-30003048 CCTTCTGCCCTGACGGGTCTGGG - Intergenic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1007485832 6:42179847-42179869 CATTCTGCCCTGGGGGACCCTGG + Exonic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1008426947 6:51369857-51369879 CATTCTCCCCTACTGGATCTTGG + Intergenic
1012696196 6:102387243-102387265 CATTATGGCCTGATGGATTTTGG - Intergenic
1015329027 6:131955684-131955706 CATTTAGCCCTGATGAAGCAAGG - Intergenic
1016123412 6:140371755-140371777 CATTCTGATCTGATGGTGGTGGG + Intergenic
1016322080 6:142857431-142857453 CATTATGGCCGGATGGTGCTTGG - Intronic
1018450927 6:163906734-163906756 CCTTCAGCACTGATGGAGTTTGG + Intergenic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1022027147 7:26459340-26459362 CAACCTGCCTTGTTGGAGCTGGG + Intergenic
1022861776 7:34375112-34375134 CAAAGTGCCCTGATGGAGATTGG - Intergenic
1023198295 7:37665773-37665795 CCTTCTGCCCTGCTGGGCCTTGG + Intergenic
1023225607 7:37965818-37965840 TATTTTCCCCTGATGAAGCTGGG + Intronic
1023413377 7:39909734-39909756 CAGTCTGCCCTGGTGAAGCAGGG - Intergenic
1024363745 7:48497781-48497803 CATTGGGCCCTGATGACGCTGGG + Intronic
1024683835 7:51723089-51723111 CATGCTGGCCTCATGGAGTTAGG + Intergenic
1025041672 7:55651290-55651312 CATTTTCCCCTGCTGGTGCTGGG + Intergenic
1027572112 7:79882639-79882661 CATAATGCCCTGTTGGAACTGGG + Intergenic
1028251353 7:88543026-88543048 CTTTCCTCCCTGAGGGAGCTGGG - Intergenic
1030059718 7:105612942-105612964 CACACTGCCCTGATGGGTCTAGG + Intronic
1031751994 7:125586562-125586584 CATTCTCCACTAATGGACCTAGG - Intergenic
1033213186 7:139475584-139475606 GATTCTGTCCTTATAGAGCTGGG - Intronic
1033483680 7:141766780-141766802 CATTGTGACTTGGTGGAGCTTGG + Intronic
1035322667 7:158043549-158043571 CATTCTCTCCTGCAGGAGCTTGG - Intronic
1035458051 7:159022429-159022451 CAGTCTGTCCTGGTGGTGCTGGG + Intergenic
1035771197 8:2148237-2148259 CATTCTGCCCTGAGGGAGTAGGG - Intronic
1039426780 8:37493009-37493031 AGTTCTGCCCTGACGGAACTAGG + Intergenic
1039571399 8:38589490-38589512 TATCTTGCCCTGATGGTGCTTGG + Intergenic
1039995162 8:42526012-42526034 TATTCTGCCCTCAAGGAGGTAGG + Intronic
1040532350 8:48276112-48276134 CATGCAGCCCTGATGGTGCAGGG - Intergenic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1043543980 8:81294780-81294802 GATTCTAGCCTGATGGAGCATGG + Intergenic
1044494239 8:92858347-92858369 CATTCTGTCTTGATGAATCTTGG - Intergenic
1045548250 8:103147653-103147675 CATTCTGCCCTTGTGAAGTTGGG + Intronic
1046395825 8:113637624-113637646 AACTCTGCCCTGATAGAGTTAGG + Intergenic
1047846810 8:128815027-128815049 CACTTTGACCTGATGAAGCTGGG - Intergenic
1049299309 8:141861369-141861391 CATTCCTCCGTGCTGGAGCTGGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1050584745 9:7099015-7099037 CATTGTTCCCTGTTTGAGCTGGG + Intergenic
1052012565 9:23427863-23427885 CATTCTGTACTAATGGAGTTGGG + Intergenic
1052789678 9:32863630-32863652 CATTTTGCACTGATGAAGATAGG + Intergenic
1053425711 9:38008707-38008729 CATCCTGCCATGATCCAGCTGGG + Intronic
1056403849 9:86255397-86255419 CAATCTGCCTTGATGCAGCCTGG + Intronic
1059428538 9:114236328-114236350 CAGACTGCCCTGATGGAGCTCGG + Intronic
1059874626 9:118620595-118620617 GATTTTGCCCTGCAGGAGCTAGG + Intergenic
1060032118 9:120223950-120223972 ACTTCTGCCTTGATGGAGTTGGG - Intergenic
1060465029 9:123896124-123896146 TATTTTTTCCTGATGGAGCTGGG - Intronic
1061078763 9:128357530-128357552 CAGGCAGCCCTGAGGGAGCTGGG + Intronic
1061265367 9:129501734-129501756 CCTCCTGCCCTGATCAAGCTGGG + Intergenic
1062178590 9:135178505-135178527 CATTCTCCTCTGCTTGAGCTGGG - Intergenic
1186339601 X:8630043-8630065 CATTCTGCCCTGAGGGAGCATGG + Intronic
1187548958 X:20282090-20282112 GCTTCTGTCCTCATGGAGCTGGG - Intergenic
1188462161 X:30440977-30440999 CATTCTGCCCACCTGGAACTGGG + Intergenic
1189940164 X:46112983-46113005 CATTTTCCCCTGCTGGTGCTGGG - Intergenic
1189954859 X:46267373-46267395 CATTCTACCCTGATGCCCCTGGG - Intergenic
1190473245 X:50803598-50803620 CATTGTGGGCTGATGTAGCTGGG - Intronic
1190963730 X:55277942-55277964 CAATCTGGGATGATGGAGCTTGG - Intronic
1191662502 X:63665851-63665873 CCTTCTTCCCTGAGGGAGATGGG - Intronic
1191965827 X:66757223-66757245 CATTCTGCCCTGTTGCTGCATGG + Intergenic
1192257933 X:69480955-69480977 CATTCTGCCCTCAAGGAGGGGGG + Intergenic
1197355676 X:125435693-125435715 CTTTCCTCCCTGAGGGAGCTGGG - Intergenic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1201283988 Y:12363611-12363633 CAGTCTGCCCTGTGGGGGCTGGG + Intergenic