ID: 1071105388

View in Genome Browser
Species Human (GRCh38)
Location 10:82087828-82087850
Sequence TAATAGGCTGAGACCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071105388_1071105391 -4 Left 1071105388 10:82087828-82087850 CCACTCCAGGTCTCAGCCTATTA 0: 1
1: 0
2: 1
3: 11
4: 203
Right 1071105391 10:82087847-82087869 ATTAGCACATCCTAGTTCCCTGG No data
1071105388_1071105393 9 Left 1071105388 10:82087828-82087850 CCACTCCAGGTCTCAGCCTATTA 0: 1
1: 0
2: 1
3: 11
4: 203
Right 1071105393 10:82087860-82087882 AGTTCCCTGGCCATGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071105388 Original CRISPR TAATAGGCTGAGACCTGGAG TGG (reversed) Intronic
900507380 1:3036491-3036513 CCATGTGCTGAGACCTGGAGTGG - Intergenic
903177766 1:21590825-21590847 TAACAGGATGACACATGGAGAGG + Intergenic
903275800 1:22220835-22220857 GAGTAGACTGAGACCTAGAGAGG + Intergenic
905524358 1:38625107-38625129 TGATAGGCTGAGACTTGCACTGG - Intergenic
905882297 1:41472125-41472147 CAAAAGACTGAGATCTGGAGAGG - Intergenic
906860867 1:49357706-49357728 GAATAGACTGAGGCTTGGAGTGG - Intronic
908880100 1:68722456-68722478 TAAGAGGCTGGGAGCAGGAGGGG - Intergenic
909083248 1:71140632-71140654 GAGGAGGCTGAGTCCTGGAGTGG + Intergenic
909979461 1:82081471-82081493 TGAAAGCCTGAGACCTGGGGTGG + Intergenic
910207971 1:84766500-84766522 AAGGAGGCTGAGACATGGAGAGG - Intergenic
911830526 1:102545370-102545392 TCATAGGCTTACAGCTGGAGAGG - Intergenic
915181437 1:154064479-154064501 ATTTATGCTGAGACCTGGAGTGG - Intronic
915281674 1:154826848-154826870 TTACAGACAGAGACCTGGAGGGG + Intronic
917025070 1:170632441-170632463 TAATATGCTGAGAGCTCTAGTGG - Intergenic
920186918 1:204165422-204165444 TGATAAACTGAGACTTGGAGAGG + Intronic
920470691 1:206226530-206226552 GAAGAGGCTGAGGCCAGGAGAGG - Intronic
920615009 1:207483305-207483327 GAATAGGCTCAGACATGAAGGGG + Intronic
922515327 1:226203788-226203810 GAAAAGGCTCAGGCCTGGAGAGG - Intergenic
923338688 1:232990574-232990596 TAAGTGGCTGAGGCCAGGAGGGG + Intronic
1063971684 10:11385537-11385559 TAATGGGCTGACACCTGGAATGG - Intergenic
1064128582 10:12687112-12687134 AAATAGGAAGAGACCTGAAGTGG + Intronic
1066591687 10:37001643-37001665 TAATAAGATGAGGCCAGGAGCGG - Intergenic
1068990088 10:63140987-63141009 CACTAGGCTGAGGCCAGGAGCGG - Intronic
1070595457 10:77829756-77829778 GAAGACGCTGAGGCCTGGAGGGG - Intronic
1071105388 10:82087828-82087850 TAATAGGCTGAGACCTGGAGTGG - Intronic
1071117707 10:82242592-82242614 TGTTTTGCTGAGACCTGGAGAGG + Intronic
1072019153 10:91381436-91381458 TAATAGGCTGAGAGGTGGTAGGG - Intergenic
1072497694 10:95978665-95978687 TAATAGGCTGAGGCTTGGCTGGG - Intronic
1074249573 10:111731092-111731114 TGACAGGCTGAGACTGGGAGGGG - Intergenic
1074526845 10:114270112-114270134 GATTAAGCTGAGCCCTGGAGAGG + Intronic
1076003693 10:126931534-126931556 TCATGGGCTCAGACTTGGAGAGG + Intronic
1079079311 11:17402859-17402881 TAAGAAGCTGAGGCCTAGAGAGG - Intronic
1080609448 11:33891576-33891598 TCATAGGCTGTGACTTGGAGAGG - Intronic
1084176489 11:67424948-67424970 GAAGAGAGTGAGACCTGGAGAGG - Exonic
1084515211 11:69634287-69634309 TAAAAGGCAGAGGCCTGGGGGGG + Intergenic
1084676178 11:70636066-70636088 ATTTAGGCTGAGACCTGAAGAGG - Intronic
1085317438 11:75554149-75554171 TCAGAGGCTGGGAGCTGGAGCGG - Intergenic
1086336491 11:85806304-85806326 TAAGTGGCTCAGAACTGGAGAGG - Intronic
1087855043 11:103081657-103081679 TAATAGTCTGAGACCTAGAGAGG - Intronic
1089080649 11:115773745-115773767 TAGTGGGCTGAGAGCTGAAGTGG + Intergenic
1089937005 11:122375086-122375108 TAAGAGGCAGAGAACTGCAGGGG + Intergenic
1090359827 11:126164586-126164608 GAAAAAACTGAGACCTGGAGAGG + Intergenic
1090729277 11:129555656-129555678 TCATAGGCTCACAGCTGGAGGGG + Intergenic
1091839904 12:3613469-3613491 TAATAGGATGAGGCAGGGAGAGG - Intronic
1095493170 12:42757414-42757436 TAATAGGTAGAAAGCTGGAGTGG + Intergenic
1095601008 12:44013321-44013343 TAAAAGTCTGAGACCTAGACTGG - Intronic
1096733829 12:53636752-53636774 TTATAGGCTGATACCTGATGTGG - Intronic
1097007625 12:55930695-55930717 TGAGAGGGTGAGACTTGGAGGGG + Intronic
1097039184 12:56144293-56144315 TAAGAGGCTCACAGCTGGAGAGG - Intronic
1097838352 12:64296484-64296506 TTACAGGCTGACAACTGGAGAGG + Intronic
1098753169 12:74321860-74321882 TTATAGGCTCAGAACTGGGGAGG + Intergenic
1102624530 12:114224510-114224532 TAAAAGGGTGAGACCAGGATTGG + Intergenic
1105624770 13:22101982-22102004 TTATAGGCTCATACCTAGAGAGG + Intergenic
1109001733 13:56813379-56813401 AAATGGGCTGATACCTGGGGTGG + Intergenic
1110490216 13:76095184-76095206 TAATAGGGTGAGGCCGGGCGCGG + Intergenic
1111982543 13:95032272-95032294 TAAGAGGCTGAGGCATAGAGAGG - Intronic
1112412760 13:99178229-99178251 GAATAGGCAGATGCCTGGAGAGG - Intergenic
1113741872 13:112716708-112716730 TCACTGGCTGAGACCTGGGGAGG - Intronic
1115258332 14:31426719-31426741 TAAGATGCTGTAACCTGGAGTGG + Intronic
1115903008 14:38175003-38175025 GTATAGGCAGAGACATGGAGTGG - Intergenic
1118545827 14:66887292-66887314 TAAAAGACTGAGACCTGGCCAGG + Intronic
1119580689 14:75777136-75777158 TAATTGGCTAAGATATGGAGAGG - Intronic
1120159672 14:81131759-81131781 GAAAAGGCAGAGACCAGGAGTGG - Intronic
1121382808 14:93489434-93489456 TCATAGGCTCACAGCTGGAGAGG - Intronic
1121515387 14:94546249-94546271 TAGAAGGCTGAGATCTGGAAAGG - Intergenic
1122374184 14:101247589-101247611 GGACAGGCTGAGGCCTGGAGAGG - Intergenic
1125613545 15:40989660-40989682 TAACTGGCAGAGAGCTGGAGTGG - Intronic
1126245206 15:46497169-46497191 TAAGAAGCTGAGGTCTGGAGAGG + Intergenic
1126845783 15:52759415-52759437 TCATAGGATGAAAGCTGGAGAGG + Intronic
1128765665 15:70249661-70249683 TAACAGGCAGAGTCTTGGAGGGG - Intergenic
1129309793 15:74698791-74698813 TAATATGCTGATACTTGGATTGG + Intergenic
1129929082 15:79394102-79394124 TAAAATGCTGAGAGCTGAAGAGG + Intronic
1130569741 15:85031208-85031230 GACTAGACTGAGGCCTGGAGTGG + Intronic
1132003091 15:98199871-98199893 AAAGAAACTGAGACCTGGAGTGG - Intergenic
1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG + Intronic
1135001283 16:18779040-18779062 GAATAGGCTGAGATATGGACAGG - Intergenic
1136002296 16:27303931-27303953 AATGTGGCTGAGACCTGGAGAGG - Intergenic
1136343934 16:29663318-29663340 TAAGAGGGTGAGACTTGGTGGGG + Intronic
1138282901 16:55785715-55785737 GAATTGGCTGAGACCTAGAGAGG + Intergenic
1138286032 16:55810883-55810905 GAATTGGCTGAGACCCAGAGAGG - Intronic
1142824739 17:2502049-2502071 TAAAAAGCTGAGACCAAGAGAGG + Intronic
1143116193 17:4583039-4583061 TCTTGTGCTGAGACCTGGAGGGG + Intergenic
1144258460 17:13493755-13493777 TAATAGGCTTTGACCTTGATTGG - Intergenic
1144783914 17:17821497-17821519 TTTTAGGATGAGACCAGGAGTGG - Intronic
1147389009 17:40098097-40098119 TACCAGGCTGAGATCTGAAGGGG - Intronic
1148383315 17:47216641-47216663 TAAGAGGGTGAAACCTGAAGAGG - Intronic
1152369310 17:79876282-79876304 AAAGAGGCTGAGGCCTGGTGTGG - Intergenic
1153999816 18:10473654-10473676 TCATAGGGTGATACCTGGACTGG + Intronic
1158392578 18:57055613-57055635 TAATGGGCTCAGATCTGGACAGG - Intergenic
1159757650 18:72385731-72385753 TAATGGGCTAAGACCTGGGATGG + Intergenic
1160591246 18:79945751-79945773 GCAGAGGCTGAGGCCTGGAGGGG - Intronic
1161146137 19:2679429-2679451 TACGAGGCTGTGACCTGGATGGG - Intronic
1163567509 19:18060181-18060203 TAACATCCTGAGACCTGGACGGG + Intronic
1164625211 19:29723352-29723374 AAATCGTCTGAGAACTGGAGGGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165685968 19:37820114-37820136 AAATAGTTTGAGACCTGGAATGG + Intergenic
1167214433 19:48155011-48155033 TCACATGCTGAGGCCTGGAGGGG - Intronic
925181753 2:1822024-1822046 AAAGAGGCTGGGACCTAGAGTGG - Intronic
925869308 2:8255267-8255289 TAAGAGGCTGGGACCTGATGGGG + Intergenic
926301075 2:11603024-11603046 GAAGAGGCTGAGGCTTGGAGAGG + Intronic
927089741 2:19701174-19701196 TAACATGCTGAGCCCAGGAGAGG - Intergenic
927165157 2:20312400-20312422 TAATAGGCTGGGACATTGAATGG + Exonic
927967619 2:27281335-27281357 TAGTAGGCTGTGACCCTGAGTGG - Exonic
928378982 2:30802130-30802152 GAGTAGGCTGAGCCCTGGACTGG + Intronic
930239434 2:48921149-48921171 TCATAGGCTCACAGCTGGAGGGG - Intergenic
930358991 2:50354768-50354790 TAATATGCCCAGACCTGGAAGGG - Intronic
933378998 2:81518941-81518963 TCATAGACTGAGACCAGGAAGGG + Intergenic
933425462 2:82106163-82106185 TTGTATACTGAGACCTGGAGAGG - Intergenic
934522975 2:95031468-95031490 TGACTGGCTGAGACTTGGAGCGG + Intronic
935191121 2:100779598-100779620 AAATGGGCTGAGCACTGGAGGGG - Intergenic
936786904 2:116104269-116104291 AGACAGGCTGAAACCTGGAGTGG + Intergenic
936955804 2:118021132-118021154 AAAGAGGGTTAGACCTGGAGCGG + Intergenic
937817091 2:126263077-126263099 ATATAGGCTGAGACCTCCAGAGG + Intergenic
939971601 2:148668185-148668207 TAAAAAACTGAGACCAGGAGTGG - Intronic
940093857 2:149951932-149951954 TCACAGGCTCACACCTGGAGGGG - Intergenic
940372726 2:152920928-152920950 TAATATGCTCAGAGCAGGAGTGG + Intergenic
943811741 2:192195734-192195756 TAATAGGCTACGGGCTGGAGAGG - Intergenic
945029175 2:205647863-205647885 GAGAAAGCTGAGACCTGGAGAGG - Intergenic
945562169 2:211352472-211352494 GAGTTGGCTGAGACCTGGATAGG + Intergenic
946032981 2:216719728-216719750 GAAGAAACTGAGACCTGGAGAGG + Intergenic
946799825 2:223402233-223402255 TAATAGGATGAGACCTTGGGAGG + Intergenic
947909721 2:233793069-233793091 CAAGAGGCTGAGACATGGTGGGG + Intronic
948017657 2:234703110-234703132 TATTATCCTGAGACCTGGGGTGG + Intergenic
948329059 2:237150818-237150840 GAGTAGGCTGAGTCCAGGAGAGG + Intergenic
948890757 2:240905953-240905975 TGGTGGACTGAGACCTGGAGAGG - Intergenic
1170790402 20:19504091-19504113 TGATAGGCTGAGTCTTGGATGGG - Intronic
1170853922 20:20031191-20031213 TTACAGTCTGATACCTGGAGGGG - Intronic
1171511762 20:25691587-25691609 CCATAGACTGAGAACTGGAGAGG + Intronic
1173519175 20:43686521-43686543 TATTGGGTTGAGCCCTGGAGAGG + Intronic
1174497880 20:50961833-50961855 TAAATGACTGTGACCTGGAGTGG + Exonic
1178379959 21:32099555-32099577 TTTTAGGGTGAAACCTGGAGTGG - Intergenic
1178503001 21:33141119-33141141 TAAGAGGCTGGAACCTGGGGTGG + Intergenic
1181000054 22:19983831-19983853 AAATAGACTGAGGCCTAGAGTGG + Intronic
1181472701 22:23150765-23150787 TGACACGCTGAGACCTGAAGGGG - Intronic
1182234465 22:28864620-28864642 TAATAGGCAGGAAGCTGGAGCGG + Intergenic
1183391048 22:37545917-37545939 CAAGAGGCTGAGACCGGCAGGGG - Intergenic
1184698887 22:46156058-46156080 TGATAGGTTGAGACCTGGCAAGG - Intronic
956114779 3:65907324-65907346 TCACAGGCTGAGACCTGGTAAGG + Intronic
956327923 3:68073550-68073572 TAATAGGCTATGTCCTGGTGAGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
961130374 3:124460668-124460690 AAGGAGTCTGAGACCTGGAGAGG + Intronic
961782576 3:129329387-129329409 GTAGAGGCTGAGACCTGAAGAGG - Intergenic
962133760 3:132710661-132710683 AAATAGGGTGAGTCCGGGAGAGG - Intronic
962845847 3:139273256-139273278 TAAGAGGCTGAGTCCAGGAAAGG + Intronic
964355682 3:155849818-155849840 GAATAGCTTGAGCCCTGGAGGGG + Intronic
965795792 3:172437430-172437452 AAATCAGCTGAGACCTAGAGAGG + Intergenic
966091542 3:176144292-176144314 TCATAGGCTGAGTCTTGGAATGG - Intergenic
966387179 3:179411637-179411659 TAATGGGCTGAGAGATAGAGAGG + Intronic
966613374 3:181890016-181890038 GGAAAGGCTGAGGCCTGGAGAGG + Intergenic
966787866 3:183636534-183636556 TAAGAAACTGAGTCCTGGAGTGG - Intronic
971530739 4:27685371-27685393 TAAGAGGCTGAGACCTGGGAAGG - Intergenic
973109942 4:46386077-46386099 TAATCGGCTTAGACCAGGACTGG - Exonic
973671491 4:53223434-53223456 AAAAGGGCTGACACCTGGAGGGG - Intronic
974399187 4:61379172-61379194 TAGTCGGGTGAGACCTGAAGGGG + Intronic
976228299 4:82814212-82814234 TACTAGGCTGAGACCTGGGTTGG + Intergenic
976876535 4:89860184-89860206 GAATAGGCTGAGAACTCCAGGGG + Intergenic
978330216 4:107604385-107604407 TGAAAGGCTGACACCTGGAGAGG + Intronic
978593624 4:110353639-110353661 AAGGAGGCTGACACCTGGAGGGG - Intergenic
988013684 5:25525811-25525833 TAAGAGGCTGAGAAGTGTAGTGG - Intergenic
988220080 5:28333608-28333630 CAATAGGCTGATCCATGGAGTGG + Intergenic
988786027 5:34566008-34566030 TGATGGGCTGAGGCCTGTAGGGG + Intergenic
992094481 5:73348974-73348996 CAATTGGCTGGGACCTTGAGAGG - Intergenic
992704868 5:79380692-79380714 TTATATGCTGTGACATGGAGGGG - Intronic
995109915 5:108417853-108417875 TTATAGGCTCAGAACTGGGGAGG - Intergenic
997472576 5:134125000-134125022 TAAGAAACTGAGACCTAGAGAGG - Intronic
997633239 5:135385707-135385729 AAATCAGCTGAGCCCTGGAGAGG - Intronic
998478386 5:142440816-142440838 ATTTAGGCTGAGACCTGAAGGGG - Intergenic
1000303907 5:159978538-159978560 TAATAGACAGAGCCCTAGAGAGG - Intergenic
1001351691 5:170974209-170974231 TAACAGGCTGACAGCTAGAGGGG - Intronic
1002399614 5:178984346-178984368 GAACAGGCTGAGCCCAGGAGAGG + Intronic
1004397454 6:15258371-15258393 GAAGAAACTGAGACCTGGAGAGG - Intronic
1005392775 6:25350208-25350230 GAATAGGCCTAGACCTGGAGGGG - Intronic
1007675158 6:43587736-43587758 TAGAAGGCAGAGACCTGGCGCGG + Intronic
1007878473 6:45134573-45134595 TCATAGGCTCACAGCTGGAGAGG - Intronic
1010768462 6:79802421-79802443 TAGAAGCCTGAGATCTGGAGTGG - Intergenic
1011654022 6:89533278-89533300 TAATAGACTGAGGCCCGGAGAGG + Intronic
1011786585 6:90852964-90852986 TAATAGGCTGAGGCTTTTAGAGG + Intergenic
1013113928 6:107086327-107086349 TAAAAGACTGAGACCTGGCCAGG + Intronic
1018345447 6:162894104-162894126 GAGTAGTCTGAGACCTGGAGTGG + Intronic
1019151035 6:170006071-170006093 TGCTAGGCTGAGACCTACAGAGG + Intergenic
1022627455 7:32052479-32052501 CAATAGGCTCAGCACTGGAGGGG + Intronic
1026071863 7:67128983-67129005 TAAAAGACTGAGACCTAGACTGG - Intronic
1026705043 7:72683271-72683293 TAAAAGACTGAGACCTAGACTGG + Intronic
1027536733 7:79412737-79412759 GAGGAGGCTGAGTCCTGGAGTGG - Intronic
1028335787 7:89653119-89653141 GAATAAACTGAGGCCTGGAGAGG + Intergenic
1030995505 7:116354366-116354388 CACCAGGCTGAGATCTGGAGCGG + Intronic
1032699222 7:134364071-134364093 TTATTGCCTGAGACCTGAAGCGG - Intergenic
1033228544 7:139579608-139579630 TGAGAGGCTGAGACCTCTAGAGG - Intronic
1034626209 7:152494770-152494792 TATAAGGCAGAGAACTGGAGAGG + Intergenic
1035796959 8:2366672-2366694 TCATAGGGTGGGAGCTGGAGGGG + Intergenic
1037306202 8:17506608-17506630 TAAGAGACTGAGATCTTGAGAGG + Intronic
1037322514 8:17657276-17657298 TAAGAAGCTGAGACCGGGCGCGG + Intronic
1038447461 8:27614001-27614023 TGATAATCTGAGGCCTGGAGAGG - Intronic
1038851146 8:31277523-31277545 TAAGAGGCTTAGAACTGTAGGGG - Intergenic
1040105166 8:43537558-43537580 TCCTAGGCTGAGACCTGTGGTGG + Intergenic
1041306867 8:56470747-56470769 TCTGATGCTGAGACCTGGAGGGG + Intergenic
1043573298 8:81629528-81629550 TGATTGGCTGAAACCTGGGGAGG + Intergenic
1046726164 8:117676403-117676425 TAATGGGCTCAGACCTGGCCGGG + Intergenic
1047274381 8:123394806-123394828 GAATTGGCAGAGACCTGGAGAGG - Intronic
1047672160 8:127159958-127159980 TCATAGGCTGATACCTGCACAGG + Intergenic
1048053076 8:130837600-130837622 TAAAAGGCTGAAATCTGGTGGGG - Intronic
1049007023 8:139862263-139862285 GAAAAGGCAGAGACCTGGTGGGG - Intronic
1049014257 8:139908399-139908421 TGATAGGCTGAGGGTTGGAGAGG - Intronic
1051270119 9:15347325-15347347 TAATTAGCTGAGGACTGGAGAGG - Intergenic
1052300335 9:26946749-26946771 TAATAGTCTGAGAATTGGAAGGG + Intronic
1053369758 9:37550990-37551012 TTATAGGCTCACAGCTGGAGGGG - Intronic
1055034967 9:71808841-71808863 TAGAAGGCTGAGACCCAGAGAGG + Intronic
1059969667 9:119652534-119652556 TAATAAACTGAGACCTGAATAGG + Intergenic
1061165188 9:128918227-128918249 TAACAGGCTGTGACCTGGGCTGG + Intergenic
1061866059 9:133492270-133492292 TAGTTGGCTGAGTCCTAGAGCGG - Intergenic
1189330833 X:40144058-40144080 ACAGATGCTGAGACCTGGAGGGG + Intronic
1193214939 X:78852882-78852904 TAAAAGACTGAGATCTGGACAGG + Intergenic
1193862140 X:86682143-86682165 GACTAGGCTGAGATCTGTAGTGG - Intronic
1196066078 X:111465817-111465839 CAATAGGATGAGATCTGAAGAGG - Intergenic
1199348154 X:146766766-146766788 TAAGTGGCTGAGTCCTGAAGCGG + Intergenic
1200073616 X:153540747-153540769 TCATAGGCTGGGAGCTAGAGAGG + Intronic