ID: 1071110760

View in Genome Browser
Species Human (GRCh38)
Location 10:82152612-82152634
Sequence TGAGGTCCAAATATAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071110760 Original CRISPR TGAGGTCCAAATATAGTGAG TGG (reversed) Intronic
900271553 1:1792339-1792361 GGAGGTACAAATATATAGAGGGG + Intronic
900303413 1:1989432-1989454 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
902501288 1:16913487-16913509 GGAGGTCCAAGTCCAGTGAGAGG + Intronic
908745543 1:67372791-67372813 TGAGAACCAAATGCAGTGAGTGG + Intronic
909042189 1:70668025-70668047 TGAGGTCCAAGTAGTGTCAGAGG + Intergenic
912090775 1:106072639-106072661 TAAGGTCCAAATACAATTAGAGG + Intergenic
912391774 1:109307822-109307844 TGAAGTACAAATAAAGGGAGAGG + Intergenic
915195167 1:154183551-154183573 TGTGGAGCAAATACAGTGAGGGG - Intronic
917683324 1:177390579-177390601 TTAGGACAAAATAGAGTGAGTGG - Intergenic
918805571 1:189037096-189037118 TGAGGACAAAATATAATTAGTGG - Intergenic
1064289669 10:14022171-14022193 TGAGGTCAACAAATAATGAGTGG + Intronic
1067549398 10:47223307-47223329 TGAGGTTCAGAGATAGTGAGAGG + Intergenic
1069251513 10:66272709-66272731 TGAGTTTAAAATATAGTGACAGG - Intronic
1071110760 10:82152612-82152634 TGAGGTCCAAATATAGTGAGTGG - Intronic
1072267295 10:93742943-93742965 TGAGGTCCAAAAATATTAAATGG + Intergenic
1072902554 10:99421434-99421456 TGAGGTCAAAATACAGAGAGAGG - Intronic
1073166448 10:101457495-101457517 TGAGGTCCTAAAATATTGAATGG - Intronic
1073839455 10:107481915-107481937 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1075498441 10:122949659-122949681 TGAGGTCCAAAAATATTAAATGG - Intronic
1078294293 11:10050880-10050902 TGAGGTCCAAAAATATTAAATGG - Intronic
1079481594 11:20886511-20886533 TGGGGACCAAATATATGGAGGGG + Intronic
1079643240 11:22832345-22832367 TGAGGTCCAAAAATATTAAATGG + Intergenic
1082059346 11:47847303-47847325 AGAGGACCAAATATAATTAGTGG - Intronic
1086845556 11:91745584-91745606 TGAGGTCCATATTTTGTAAGTGG + Intergenic
1087007021 11:93480842-93480864 TGGGGTCTAAATGGAGTGAGAGG - Intronic
1087481246 11:98703220-98703242 TGAGGTCCAAAAATGTAGAGTGG + Intergenic
1087515915 11:99160773-99160795 GGAGTTCAAAATACAGTGAGAGG + Intronic
1091403980 12:197576-197598 AGAGGTCAAAAGACAGTGAGAGG + Intronic
1094010857 12:25807992-25808014 TGAGGTCGAAAGAGTGTGAGGGG + Intergenic
1095994805 12:48072112-48072134 TGCGGTCCAAATATATTAAATGG + Intronic
1098466438 12:70791988-70792010 TGATGTCCAAATGTGGGGAGTGG - Intronic
1098850469 12:75589890-75589912 TGAGGTCCAAATAACTTGACTGG + Intergenic
1099326874 12:81227834-81227856 TGAGGTCCCAGAATAGTGAAAGG - Intronic
1101007995 12:100420244-100420266 AGAGGTCCAAATATTGGGAGGGG + Exonic
1101881648 12:108629928-108629950 TGAGGTCACCAGATAGTGAGAGG - Intronic
1104292717 12:127484313-127484335 TCAGGTCCAAGTGTACTGAGTGG - Intergenic
1106598583 13:31168222-31168244 TGAGGTTAAAATATATTGAGAGG + Intergenic
1108694145 13:52887998-52888020 TGAGCACCAAATATAGTAATTGG - Intergenic
1108985390 13:56580213-56580235 TGTGCACCAAGTATAGTGAGGGG - Intergenic
1111451355 13:88421971-88421993 TGAAGTTCAAATATACTCAGTGG + Intergenic
1117252328 14:53950307-53950329 TGAAGTCCACATAGAGCGAGTGG + Exonic
1117253439 14:53956146-53956168 TGAGGTCCAGAGAGAGTGAGGGG - Intronic
1117342969 14:54807510-54807532 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
1117759669 14:59014188-59014210 TGAGGTCCAAAGGAAGTGGGTGG - Intergenic
1120153532 14:81064887-81064909 TGAGATCCAAATAGAGGGATTGG + Intronic
1120573360 14:86149394-86149416 TGTGGTTCAAATATATTTAGAGG + Intergenic
1121373468 14:93382704-93382726 CAAGGTCCATATTTAGTGAGTGG + Intronic
1130775058 15:86970211-86970233 TGAGATCCCAATATACTGGGAGG + Intronic
1131694250 15:94857740-94857762 TCAGGTGAAAATATACTGAGTGG + Intergenic
1131854346 15:96577427-96577449 TGAGGTTCAAAGACAGTGATGGG - Intergenic
1135243029 16:20827163-20827185 TGAGATCCAAATCTAAGGAGTGG - Exonic
1138233065 16:55353994-55354016 GGTGGTCCAAATATATTCAGTGG + Intergenic
1139645631 16:68327643-68327665 TGAGGTCCAAAAATACTAAATGG + Intronic
1142391087 16:89800648-89800670 TGAGGTCAAAATATACTACGAGG + Intronic
1143652236 17:8270497-8270519 TGGGGTCCACAGATGGTGAGGGG + Intergenic
1144614759 17:16758605-16758627 TGAAGTCCAAATCAAGTAAGTGG - Intronic
1144897945 17:18557069-18557091 TGAAGTCCAAATCAAGTAAGTGG + Intergenic
1145134424 17:20388645-20388667 TGAAGTCCAAATCAAGTAAGTGG - Intergenic
1145193744 17:20869012-20869034 TGGGGAGAAAATATAGTGAGGGG + Intronic
1149023773 17:52000808-52000830 TGAGGTTCAAATATTAAGAGAGG + Intronic
1151042222 17:70875709-70875731 TGAAGTCAAAATAAAGTGATGGG - Intergenic
1151639990 17:75384864-75384886 TGAGGTCAAACTAGAGAGAGAGG - Intronic
1153534900 18:6090983-6091005 TGCTGTCCAAAAATAGTGATGGG - Intronic
1154285147 18:13048154-13048176 TGAGGTGCAAAAATATTCAGTGG + Intronic
1155210334 18:23595093-23595115 TGAGGGCTAAGTATAGTCAGAGG + Intergenic
1156834864 18:41540356-41540378 TGGGGTCCTAATTGAGTGAGGGG + Intergenic
1159195113 18:65103378-65103400 TGATGTCCAAATAATGTGAGAGG - Intergenic
1159517696 18:69478799-69478821 TGATATCCAAATAAAGTGTGGGG - Intronic
925586799 2:5472830-5472852 TGAGGCCCAAACAGAGTCAGAGG + Intergenic
929581823 2:43086144-43086166 TGAGGCCCAGGTATAGTGAAGGG - Intergenic
930518347 2:52434252-52434274 CCAGGTCCAAGTATACTGAGTGG - Intergenic
931101170 2:59002494-59002516 TGAGGTCCAAACCTAGGTAGTGG + Intergenic
932113779 2:69026094-69026116 TTAGGTGCTAAGATAGTGAGAGG - Intronic
932536487 2:72602833-72602855 TCAGATCCAAGTATACTGAGTGG - Intronic
932752402 2:74379765-74379787 TGAGGGCCAATTAGAGTCAGAGG + Intronic
937344727 2:121118354-121118376 TGAGGTGAAAATATAGTGGGTGG + Intergenic
940648658 2:156418444-156418466 AAAGGACCAAAAATAGTGAGTGG + Intergenic
942352005 2:175062766-175062788 TGAGGTCCAAAGGGAGTGGGTGG + Intergenic
944279296 2:197876435-197876457 GGAGGTCAAAATATTATGAGGGG - Intronic
944879038 2:203992603-203992625 TGAAGTCCAAAGACAGTAAGTGG - Intergenic
945959634 2:216119203-216119225 TGATTTCCTAATATAGTGAATGG + Intronic
948033361 2:234837695-234837717 TGTGGTCCAAAAATAGTCAGGGG + Intergenic
1173935003 20:46853695-46853717 TGAGGTCCAAAAATACTAAATGG - Intergenic
1179402221 21:41094855-41094877 TGAGATTTAAATATAGTAAGTGG - Intergenic
1181981044 22:26766755-26766777 TGGCTTCCAAAGATAGTGAGAGG + Intergenic
1182931946 22:34182738-34182760 TGAGGTCAAAAGAGAATGAGAGG + Intergenic
949189361 3:1233251-1233273 TGAGGACCAAATATATTATGTGG + Intronic
950209358 3:11108960-11108982 TCAGGTCCAAATATTTTCAGAGG - Intergenic
951243561 3:20314770-20314792 TTAAGTCCAAGTATATTGAGAGG - Intergenic
951576286 3:24117568-24117590 ACAGCTCCAAATATAGTGAAAGG - Exonic
953515258 3:43584616-43584638 TGAGGTCCAAAGGGAGTGGGTGG - Intronic
953659468 3:44881236-44881258 TCAGGACAAAAAATAGTGAGAGG - Intronic
955224628 3:57050569-57050591 TGAGGTCCAAGTATAATGGTGGG + Intronic
955401364 3:58593974-58593996 AGGGGTCCAAATATGGTGGGGGG - Intronic
955519301 3:59759452-59759474 CAAGGTCCATCTATAGTGAGGGG - Intronic
958755786 3:98247938-98247960 AGGGGTCCAAATATGGGGAGGGG - Intergenic
961143852 3:124577895-124577917 TGAACTCCAAATATGGTGGGGGG - Intronic
963737139 3:149031505-149031527 TGAGGTATAAATATAGTCTGTGG - Exonic
963974370 3:151464218-151464240 TTAGGTAAAACTATAGTGAGAGG - Intergenic
965352079 3:167625983-167626005 TAAGGTCCAAACATCGTGAATGG - Intronic
966300610 3:178475563-178475585 TGTGGCCCAAATATGGTAAGTGG - Intronic
971434111 4:26601462-26601484 TAAGGTATAAATATACTGAGAGG + Intronic
971762169 4:30780899-30780921 TGAGGTCAGAAAACAGTGAGAGG - Intronic
974981428 4:68962101-68962123 TGAGGTCCCAAGATAATGTGGGG - Intergenic
976077592 4:81317102-81317124 TGAAGTTCAAAAATAGAGAGGGG + Intergenic
977726916 4:100306728-100306750 AGAAGCCCAAATATACTGAGCGG + Intergenic
990055224 5:51567727-51567749 TGAGGTACTACTAAAGTGAGTGG - Intergenic
994968875 5:106709723-106709745 TGAAGTCCAAAAATATTGAATGG - Intergenic
998792024 5:145776119-145776141 TGTGGTCCAAAAATATTAAGTGG + Intronic
1002038155 5:176489481-176489503 GGAGGTCCAACTATTGTGGGAGG - Intronic
1003972656 6:11313708-11313730 TGAGATCCAAAGAGAGTGAGAGG - Intronic
1004215054 6:13694623-13694645 TGAGGTCCAAAAATATTAATTGG + Intronic
1009901373 6:69811654-69811676 TCAATACCAAATATAGTGAGAGG + Intergenic
1009991177 6:70844523-70844545 GGAGGGCCAAATACAGTAAGAGG + Intronic
1010765228 6:79771172-79771194 TGAGTTCCAAATTGAGGGAGAGG + Intergenic
1013417462 6:109937854-109937876 TGAGGTCCAAAGATGGCAAGGGG + Intergenic
1020643977 7:10791210-10791232 TGAGATCCAAAAATATTAAGTGG - Intergenic
1020747271 7:12093103-12093125 TGAGGTCCAAGGGTAGTGGGTGG - Intergenic
1021731799 7:23602737-23602759 TGAGGTCAAAGAATAATGAGGGG - Intronic
1021925063 7:25526237-25526259 TCAGGTGCAAAGACAGTGAGGGG + Intergenic
1027551155 7:79597674-79597696 TGAAGTCAGAATAAAGTGAGTGG + Intergenic
1027633669 7:80641872-80641894 TGGGTTCCCAATATAGTGGGAGG + Intronic
1027863718 7:83619329-83619351 TGTGTTCCAAATATTGTTAGTGG - Intronic
1028958881 7:96726392-96726414 TGCTGTCCAAATATTGTGAGAGG + Intergenic
1029295587 7:99537876-99537898 TGAGGTCCAAAGGGAGTGAGTGG - Intergenic
1031335846 7:120530716-120530738 TGAGGTAGAAATATAATAAGAGG - Intronic
1033831275 7:145256398-145256420 TAATGTTCATATATAGTGAGAGG + Intergenic
1034414788 7:150958631-150958653 CGAGGTCAAAATATTGTGAATGG - Intronic
1037296019 8:17401393-17401415 TGAGGTCCAAGAACAGGGAGTGG + Intronic
1037500816 8:19483946-19483968 TGAGGTCCAAAAATATTAAATGG + Intronic
1041991767 8:64001301-64001323 TGAGGTCCGAAGGGAGTGAGTGG - Intergenic
1044009435 8:86974594-86974616 TGAGGTTCAAATATGATGATAGG - Intronic
1044169968 8:89038235-89038257 TGAGGTTTAAATATTGGGAGTGG - Intergenic
1046204325 8:110971965-110971987 TGAGATCACAATATATTGAGTGG - Intergenic
1046539773 8:115564695-115564717 TGGGGTACCAATATTGTGAGGGG - Intronic
1046622143 8:116539419-116539441 TGAGTTCCAAAAAAAGTGACTGG - Intergenic
1047242606 8:123106175-123106197 TGTGGTCCAAATATATTCAAAGG + Intronic
1051690075 9:19702386-19702408 TTAGATACAAATGTAGTGAGGGG - Intronic
1051991693 9:23160585-23160607 TGACTTCCAAATATAGGGAAAGG + Intergenic
1052142942 9:25009981-25010003 TAAAGTCCAAATATGGTAAGGGG - Intergenic
1052975533 9:34407206-34407228 TGAGGACCAAATATTGACAGGGG + Intronic
1055993464 9:82132070-82132092 TGAGGTTCAAAGAAAATGAGTGG - Intergenic
1058878910 9:109269662-109269684 TTAGGTCCACATAAAGTGATGGG - Intronic
1059114069 9:111585098-111585120 TGGGCCCCAAATATAGTCAGAGG - Intronic
1188176086 X:26991482-26991504 TGAGGTACAAATATAATGATGGG + Intergenic
1188275474 X:28195440-28195462 TGAGGTACAAATATAGAGGAAGG - Intergenic
1188432466 X:30120267-30120289 TGAGGGCCAAATCCAGTCAGTGG + Intergenic
1192721958 X:73708551-73708573 TGAGGAACATAGATAGTGAGAGG + Intergenic
1193590496 X:83383685-83383707 TGATGTCCAATTATAATGATTGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1196084874 X:111674089-111674111 TGAGGGGCATACATAGTGAGAGG + Intronic
1197789457 X:130238270-130238292 TGAGGCCCAAATAAAATAAGTGG - Intronic
1198211443 X:134520076-134520098 TGAGGTCCAAACATAGCTACTGG - Intronic
1198849265 X:140948155-140948177 TGAGGGCCAAATATAGTATCAGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic