ID: 1071114725

View in Genome Browser
Species Human (GRCh38)
Location 10:82204638-82204660
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071114724_1071114725 -6 Left 1071114724 10:82204621-82204643 CCTAGGAGTAGTAATATCTCTCC 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1071114725 10:82204638-82204660 CTCTCCACCATTACTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr