ID: 1071116474

View in Genome Browser
Species Human (GRCh38)
Location 10:82227147-82227169
Sequence CAAGTACAAGCTGCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071116474_1071116480 4 Left 1071116474 10:82227147-82227169 CCACCCACTGCAGCTTGTACTTG 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1071116480 10:82227174-82227196 GTTTGTATCTTGGTAAGTGCAGG No data
1071116474_1071116479 -6 Left 1071116474 10:82227147-82227169 CCACCCACTGCAGCTTGTACTTG 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1071116479 10:82227164-82227186 TACTTGGGCTGTTTGTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071116474 Original CRISPR CAAGTACAAGCTGCAGTGGG TGG (reversed) Intronic
901045683 1:6394091-6394113 CCAGTAAAAGCTGCAGGCGGCGG - Intronic
901217492 1:7562927-7562949 CAAGGACCAGCTGGGGTGGGTGG - Intronic
901261606 1:7875666-7875688 CAAGCAGTAGCAGCAGTGGGTGG - Intergenic
905956562 1:42002232-42002254 CTGATAGAAGCTGCAGTGGGTGG - Intronic
909157590 1:72098139-72098161 AAAGAACAAGAAGCAGTGGGAGG + Intronic
910257018 1:85259052-85259074 CAGGGAGAAGCTGCAGCGGGGGG + Intronic
910263539 1:85314502-85314524 CAACCACAAGATGCAGTTGGGGG - Intergenic
914733883 1:150397815-150397837 GAAGCAGAAGCTGCAGTGAGCGG - Intronic
918371744 1:183868012-183868034 CAAGCACAAGGTACAGTGGGAGG + Intronic
921981652 1:221264880-221264902 CAAGGAAAAGCTGTATTGGGAGG + Intergenic
924641247 1:245835693-245835715 CAAGAACAATCTGCAGGGGCAGG + Intronic
1067345215 10:45433325-45433347 CAGGTGCATGTTGCAGTGGGCGG + Intronic
1071116474 10:82227147-82227169 CAAGTACAAGCTGCAGTGGGTGG - Intronic
1072983494 10:100119181-100119203 GGAGTACAAGCTGCTATGGGAGG - Intergenic
1076661557 10:132059002-132059024 CAAGCCCCAGCTGCAGTGGTTGG + Intergenic
1077059849 11:613305-613327 CAAGTGCAAGGTGTACTGGGAGG - Exonic
1080751559 11:35155221-35155243 CAAATCCCAGCTCCAGTGGGTGG - Intronic
1082679552 11:56151879-56151901 AAAGTAGAAGCAGCAGTGGATGG + Intergenic
1084207588 11:67604988-67605010 CAAGTAGGTGCTCCAGTGGGTGG + Exonic
1087191702 11:95261239-95261261 AAAGTACCAGCTGCAGTTGAGGG - Intergenic
1090280411 11:125451514-125451536 CCAGAACAGGCTGCAGTGGGCGG + Intronic
1090421240 11:126576629-126576651 CAAGGCCAAGCTGTGGTGGGTGG - Intronic
1090853603 11:130592631-130592653 CAAGTCCAAGCTGCCCTGGCAGG - Intergenic
1092943686 12:13433808-13433830 CAAGAACAAGTTACAGTGGCAGG + Intergenic
1093490690 12:19700954-19700976 CAAGGGGAAGCTGCAGTCGGGGG - Intronic
1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG + Intergenic
1103470339 12:121175238-121175260 CAAGTCAAGGCTGCAGTGAGTGG + Intronic
1105468908 13:20673732-20673754 AAAGAAAAAGCAGCAGTGGGAGG - Intronic
1108275686 13:48807403-48807425 CAGGTGCAGGCTTCAGTGGGGGG - Intergenic
1108607464 13:52053882-52053904 CAAGGACAAGGTGCAGTAGAAGG - Intronic
1111672310 13:91347552-91347574 CAAGAACGAGCCGCCGTGGGCGG + Intergenic
1113780116 13:112971943-112971965 CATGTACATGCTGTAGTTGGAGG - Intronic
1114566827 14:23639266-23639288 CATGGCCAAGCTGCAGGGGGAGG + Exonic
1114816563 14:25965825-25965847 GAAGTACAACTTGCTGTGGGAGG + Intergenic
1115255461 14:31396333-31396355 CAAGCAGAGGGTGCAGTGGGAGG + Intronic
1119826782 14:77663432-77663454 CAAGTACAAGGTGTAGTGGGAGG - Intergenic
1120750198 14:88190296-88190318 AAAGCATAACCTGCAGTGGGTGG - Intronic
1121924534 14:97915689-97915711 CAAGCACAAAGGGCAGTGGGGGG + Intergenic
1125892577 15:43277287-43277309 GAAGTGCCAGCTCCAGTGGGTGG + Intronic
1127148169 15:56047354-56047376 AAAGTACAAGGTGAAGTGGCAGG - Intergenic
1130758229 15:86789381-86789403 AAAGTACAAGCTGCGGTGATGGG - Intronic
1132803104 16:1763771-1763793 CAAGTACAAGCAGGTGCGGGCGG + Exonic
1135237017 16:20766652-20766674 GAAGTTCAAGCTGCAGTGAGGGG + Intronic
1139366892 16:66439075-66439097 CAAGGGACAGCTGCAGTGGGAGG + Intronic
1140030009 16:71328157-71328179 CAAGGACAACCTGCAGTGCAGGG + Intergenic
1141198558 16:81879792-81879814 CAAGTAGAAGCTGGAGGGAGGGG + Intronic
1142274500 16:89110053-89110075 AAAAGACAAGCTGCAGTTGGAGG - Intronic
1142888214 17:2926546-2926568 CAAGTACAAGCTGGCTTTGGGGG - Intronic
1144514620 17:15908662-15908684 CCAGGACAAATTGCAGTGGGTGG - Intergenic
1144826222 17:18107165-18107187 CAAGTACAGTCCGCAGCGGGTGG + Exonic
1144946735 17:18973203-18973225 CAAGCCCATGCTGCATTGGGAGG - Intronic
1145127459 17:20314095-20314117 CCAGGAAAAGCTGCAGTAGGTGG - Exonic
1146834849 17:36102534-36102556 AAAGTCCAGGCTGCAGTGAGTGG - Intergenic
1146849456 17:36209741-36209763 AAAGTCCAGGCTGCAGTGAGTGG - Intronic
1147186534 17:38716294-38716316 CCAGTACACGCGGGAGTGGGAGG + Intronic
1147381897 17:40061277-40061299 CAAGCAACAGCTGCAGTGTGGGG - Intronic
1150748768 17:67840171-67840193 GAAGTGGAAGCTGCAGTGAGTGG - Intronic
1150834961 17:68555676-68555698 CGAGTCGGAGCTGCAGTGGGGGG + Exonic
1151446206 17:74165993-74166015 CAAATACAACCTGTGGTGGGAGG + Intergenic
1153005106 18:491119-491141 CAAGGACCTGCTACAGTGGGTGG - Intronic
1153410702 18:4789459-4789481 CAAGTGGAGGATGCAGTGGGAGG - Intergenic
1155588884 18:27401659-27401681 AAAGTACAAGAGTCAGTGGGAGG - Intergenic
1159533555 18:69686147-69686169 CCAGTACAAGCTGAAGAGAGAGG + Intronic
1160761926 19:789780-789802 GAACCACAAGCTGCTGTGGGTGG + Intergenic
1161101939 19:2425710-2425732 CAGGCAGAGGCTGCAGTGGGAGG + Exonic
1161283669 19:3458363-3458385 CTAATAAAAGCTGCGGTGGGAGG + Intronic
1163664938 19:18598764-18598786 CAAGTACAAGCTTAGGTTGGTGG - Exonic
1163770582 19:19188732-19188754 CAGGTAAAATCTGCAGAGGGAGG - Intronic
1163926109 19:20345273-20345295 CATGTAGAAGTTGCAGTGAGTGG + Intergenic
1164240650 19:23385221-23385243 CAATATCAAGCTGCAGGGGGAGG - Intronic
1167159282 19:47756697-47756719 CAAGTACAAGGTGAAGCTGGTGG + Exonic
1167464740 19:49644862-49644884 CAAGCACAGGGTGGAGTGGGAGG + Intronic
925716210 2:6786410-6786432 CAAGTTCAAGTTGCAATGGAAGG - Intergenic
927406862 2:22780656-22780678 CTACTTCAAGCTGCAGTGGCTGG + Intergenic
927723160 2:25400158-25400180 TAAGTACAAACTGGAGTGTGTGG + Intronic
929030440 2:37645873-37645895 CAAGATCAAGCTGCAGGGAGAGG + Exonic
934474537 2:94585732-94585754 CACGTAGAATCTGCAGAGGGAGG + Intergenic
934557473 2:95294969-95294991 CAGGTGCTAGCTGCAGTGGGAGG + Intergenic
935811074 2:106797683-106797705 CATGCAGAGGCTGCAGTGGGGGG + Intergenic
936480270 2:112879356-112879378 CAAGTCCAAGCTACGCTGGGAGG + Intergenic
937028673 2:118720292-118720314 CAAGAAAAACCTGCAGTAGGAGG + Intergenic
937354812 2:121191634-121191656 CAAGGAGAAGTGGCAGTGGGTGG + Intergenic
938314989 2:130319057-130319079 CAGGTACATCCAGCAGTGGGAGG - Intergenic
939057709 2:137383621-137383643 CAAGCACAAGCTCATGTGGGTGG - Intronic
940623961 2:156149358-156149380 AAAGTACAGACTGAAGTGGGGGG + Intergenic
940650326 2:156435558-156435580 CAAGCCCAAGCTCCAGGGGGTGG - Exonic
941096838 2:161246989-161247011 CAATTGCAAGCTGTAGTGGAAGG - Intergenic
941854338 2:170214950-170214972 CAAACACAAGCTGGAGGGGGTGG + Intronic
943706623 2:191041920-191041942 CAAGGTCAAGCTGCAGTCAGGGG + Intronic
944351279 2:198730165-198730187 CAAGTCAAAGAGGCAGTGGGTGG - Intergenic
944425485 2:199577995-199578017 CAGGGAGAAGTTGCAGTGGGTGG - Intergenic
1172446334 20:34995383-34995405 CAAGTCCAAGGTGCAGCTGGAGG + Exonic
1172505902 20:35462406-35462428 CCAGTACCAGCTGCAGTGACTGG - Exonic
1174275681 20:49402250-49402272 GAGGTACAAGCTGGAGTGGCAGG - Intronic
1175302749 20:57954383-57954405 CATGGGCAAGATGCAGTGGGAGG + Intergenic
1178384589 21:32138844-32138866 CTAGTACAAACTGAAATGGGAGG - Intergenic
1179075094 21:38113536-38113558 CAGGGAGTAGCTGCAGTGGGGGG - Intronic
1179541196 21:42084153-42084175 GATGTCCAAGCTGCAGGGGGAGG - Exonic
1180782240 22:18527812-18527834 CAAGTGCCATCTGCAGTGTGGGG + Exonic
1181239128 22:21467150-21467172 CAAGTGCCATCTGCAGTGTGGGG + Intergenic
1181285732 22:21751005-21751027 GAAGTCAAAGCTGCAGTGAGTGG - Intergenic
1181714755 22:24716588-24716610 GGAGTACAAGCTGGAGTGGTGGG - Intergenic
1182658492 22:31908331-31908353 GAAGTACAAAGTGCTGTGGGAGG - Intergenic
1183739469 22:39662045-39662067 CAAGCACAAGCCGCCGTCGGCGG + Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
953927775 3:46991086-46991108 CAAGTAAAAGATCCAGTGTGAGG - Intronic
954115550 3:48465178-48465200 CTGGAACAGGCTGCAGTGGGCGG - Intronic
954390380 3:50265353-50265375 CCAGTCCAGGCTGCACTGGGAGG + Intergenic
954816837 3:53289079-53289101 GAAGTTGAAGCTGCAGTGAGTGG - Intronic
954891204 3:53930597-53930619 GAAGTGGAGGCTGCAGTGGGTGG + Intergenic
956435500 3:69231208-69231230 AAAGTACAATATACAGTGGGGGG + Intronic
961179501 3:124865555-124865577 GAAGTTGAAGCTGCAGTGAGTGG - Intronic
961208141 3:125103701-125103723 GAAGTTGAAGCTGCAGTGAGTGG - Intronic
965152964 3:165005887-165005909 CAAGTATAAGCTGCTGTGCCTGG + Intronic
966552420 3:181219827-181219849 AAAGAACATGCTGCAGTGAGAGG - Intergenic
966736083 3:183188228-183188250 CAAGGACCAACTGCAGTGGCAGG + Intronic
967352723 3:188531923-188531945 CAATCACAAGCTGCGGTGGTGGG - Intronic
968059564 3:195717035-195717057 CAGGTGCCAGCTGCAGTGCGTGG - Intergenic
968132953 3:196202685-196202707 CAAGCTCAAGCTGCTGTGTGCGG + Intronic
973918553 4:55661572-55661594 CATGTACTATCTGGAGTGGGTGG + Intergenic
976030855 4:80751737-80751759 CAAGTTCCAGGGGCAGTGGGTGG - Intronic
976850194 4:89536167-89536189 CAAGGACAAGCTGCATTGGAGGG + Intergenic
982108241 4:152029830-152029852 CAAGTCCAAGCAGCAGAGCGTGG - Intergenic
982318635 4:154057417-154057439 CAAGTACCACCTCCTGTGGGTGG + Intergenic
983651455 4:170040524-170040546 CAAGTCCACACTCCAGTGGGTGG - Intergenic
983679752 4:170339754-170339776 GAGGTACAAGCTGGAGTGGTGGG - Intergenic
985294943 4:188426980-188427002 CAAGCAGAGGCTGCAGTGAGCGG - Intergenic
985861696 5:2476603-2476625 CAAGGACAAGCTCCAGTGAGTGG + Intergenic
988139953 5:27224790-27224812 CAAGTCCAACCTGCATTGGTGGG + Intergenic
989498006 5:42131829-42131851 CAAGTGCAAGCTGTAGTAGGCGG - Intergenic
990236969 5:53778944-53778966 CCAGGACATTCTGCAGTGGGAGG - Intergenic
990723378 5:58724487-58724509 CAAGTACAAGCCACTGTGGGGGG - Intronic
991626736 5:68610743-68610765 TAGGTACAGGCTGCAGTGGGTGG - Intergenic
992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG + Intronic
993392720 5:87340795-87340817 AAAGTACAAGCTACAGTGGTGGG + Intronic
993837771 5:92835724-92835746 CTAGAAAAAGCTGCAGTTGGAGG - Intergenic
997920684 5:137976301-137976323 TAGGTAGAAGCTGCAGTGTGTGG - Intronic
997920851 5:137977725-137977747 TAGGTAGAAGCTGCAGTGTGTGG - Intronic
1001639142 5:173232949-173232971 CAAGTGCAAGCGGCAGCGGCAGG - Exonic
1001881573 5:175249229-175249251 CTAGTACAAGCTACGGTTGGTGG - Intergenic
1003964503 6:11240175-11240197 CAAGGACAAGCTGCCTGGGGTGG + Intronic
1007305989 6:40905295-40905317 CAACTAGAAGCTACAGTGGGAGG + Intergenic
1008638957 6:53441944-53441966 CATGGCCAAGTTGCAGTGGGAGG - Intergenic
1009949210 6:70376173-70376195 CAAGTACATGCTGCAGTTATGGG + Intergenic
1012283721 6:97362841-97362863 GAAGTCCAGGCTGCAGTGAGTGG - Intergenic
1013646773 6:112150510-112150532 CAACTACAAGCAGCAGAGAGAGG - Exonic
1015308968 6:131743752-131743774 GAAGTAGAAGTTGCAGTGAGTGG + Intronic
1019572788 7:1720735-1720757 CAAGTACTAGGTGCGGGGGGTGG - Intronic
1021094308 7:16517942-16517964 CATCTACAAGCTACAGTGGCAGG - Intronic
1022034021 7:26517197-26517219 CAGCTACAAGCTGAGGTGGGAGG - Intergenic
1023948053 7:44819320-44819342 CTAGCTGAAGCTGCAGTGGGAGG + Intronic
1024289399 7:47790825-47790847 GAGGTAGAAGCTGCAGTGAGGGG - Intronic
1027251769 7:76403285-76403307 CAAGTACAGGCTGCAGGGGGTGG - Intronic
1028814910 7:95132693-95132715 CAAGTGCAGCCTGCAGCGGGCGG - Intronic
1032598062 7:133262255-133262277 CAACTACAGGCTGAGGTGGGAGG + Intronic
1033686814 7:143647546-143647568 CATGTACAAGCAGCTGTGAGGGG + Intronic
1033688920 7:143719761-143719783 CATGTACAAGCAGCTGTGAGGGG - Exonic
1033697795 7:143810068-143810090 CATGTACAAGCAGCTGTGAGGGG - Intergenic
1034333907 7:150308150-150308172 CAAGTACAACCTCCCCTGGGTGG + Intronic
1035098182 7:156374020-156374042 GAAGTCGAAGCTGCAGTGAGTGG + Intergenic
1037095651 8:14983267-14983289 CCAGTTCAACCTGCAGTTGGAGG - Intronic
1039514107 8:38117156-38117178 GAAGAACAAGCTGCAATGGGTGG - Intronic
1046470153 8:114661991-114662013 TAATCACAAGCTGCAGAGGGAGG - Intergenic
1052855517 9:33404018-33404040 CACGTAGAATCTGCAGAGGGAGG - Intergenic
1053465756 9:38307168-38307190 GCAGTCCAAGATGCAGTGGGAGG + Intergenic
1053683529 9:40500370-40500392 CATGTAGAATCTGCAGAGGGAGG - Intergenic
1053933511 9:43128688-43128710 CACGTAGAATCTGCAGAGGGAGG - Intergenic
1054280186 9:63124551-63124573 CATGTAGAATCTGCAGAGGGAGG + Intergenic
1054296633 9:63335867-63335889 CACGTAGAATCTGCAGAGGGAGG - Intergenic
1054394650 9:64640373-64640395 CATGTAGAATCTGCAGAGGGAGG - Intergenic
1054429298 9:65145573-65145595 CATGTAGAATCTGCAGAGGGAGG - Intergenic
1054501085 9:65875958-65875980 CATGTAGAATCTGCAGAGGGAGG + Intergenic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1060546629 9:124465771-124465793 CTAAGACAAGCTGCAGCGGGAGG + Intronic
1061482120 9:130902538-130902560 TAAGCACAAACTTCAGTGGGAGG + Exonic
1187149533 X:16669079-16669101 TAAGGAAAAGCAGCAGTGGGGGG + Intronic
1187151475 X:16685493-16685515 CTACTTCAAGCTGCTGTGGGAGG + Intronic
1187566706 X:20457482-20457504 TAAGTATAACCTGAAGTGGGTGG + Intergenic
1188256727 X:27970443-27970465 CAAGTAAAAGCACCAGTGGGCGG - Intergenic
1189753077 X:44242766-44242788 CAAATACAGGGTGCAGTAGGAGG - Intronic
1194455650 X:94099688-94099710 CAAGTGAAAGTTGCTGTGGGTGG - Intergenic
1195568380 X:106371637-106371659 CAAGAACAAGCCCCAGTGTGTGG - Intergenic
1196976337 X:121161748-121161770 TAAGTACAAGTATCAGTGGGTGG - Intergenic
1198395057 X:136212121-136212143 AAAGTACAAGCAGAACTGGGTGG + Intergenic
1202266117 Y:23021040-23021062 ACAGTAGAAGCTGCTGTGGGTGG + Intergenic
1202419110 Y:24654783-24654805 ACAGTAGAAGCTGCTGTGGGTGG + Intergenic
1202451676 Y:25015301-25015323 ACAGTAGAAGCTGCTGTGGGTGG - Intergenic