ID: 1071116903

View in Genome Browser
Species Human (GRCh38)
Location 10:82232555-82232577
Sequence CAGACTTCTGACCGTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071116899_1071116903 21 Left 1071116899 10:82232511-82232533 CCTCAAATTCCAGATCTCATTTT 0: 1
1: 0
2: 2
3: 37
4: 463
Right 1071116903 10:82232555-82232577 CAGACTTCTGACCGTTTTTCTGG No data
1071116900_1071116903 12 Left 1071116900 10:82232520-82232542 CCAGATCTCATTTTGCTGTCTTC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 1071116903 10:82232555-82232577 CAGACTTCTGACCGTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071116903 Original CRISPR CAGACTTCTGACCGTTTTTC TGG Intronic
No off target data available for this crispr